Incidental Mutation 'R6966:Cnot1'
ID541999
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95724532 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 2189 (L2189Q)
Ref Sequence ENSEMBL: ENSMUSP00000148807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: L2191Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: L2191Q

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: L2196Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: L2196Q

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211887
AA Change: L2189Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTTAAATCTGGGGATGGATGTC -3'
(R):5'- GAAGGGCTTGTTAACATCTGTG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- GCTTGTTAACATCTGTGATTGATTG -3'
Posted On2018-11-28