Incidental Mutation 'R6966:Mical1'
ID542007
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 1
SynonymsNical
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41476314-41487032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41479754 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 198 (Q198L)
Ref Sequence ENSEMBL: ENSMUSP00000097519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000151486]
Predicted Effect probably damaging
Transcript: ENSMUST00000019967
AA Change: Q271L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823
AA Change: Q271L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099934
AA Change: Q198L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823
AA Change: Q198L

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119962
AA Change: Q271L

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823
AA Change: Q271L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126436
AA Change: Q271L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823
AA Change: Q271L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151486
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5139:Mical1 UTSW 10 41478415 unclassified probably null
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5560:Mical1 UTSW 10 41478965 missense probably damaging 1.00
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6047:Mical1 UTSW 10 41481707 critical splice donor site probably null
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6458:Mical1 UTSW 10 41484735 missense probably benign 0.44
R6879:Mical1 UTSW 10 41484519 missense probably damaging 0.99
R7049:Mical1 UTSW 10 41482250 missense possibly damaging 0.63
R7095:Mical1 UTSW 10 41479210 intron probably null
R7156:Mical1 UTSW 10 41485257 critical splice donor site probably null
R7312:Mical1 UTSW 10 41479776 critical splice donor site probably null
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCCTAGAAGTATTACCCCAC -3'
(R):5'- GGCATTTAAGAGTCCCAGGG -3'

Sequencing Primer
(F):5'- TAGAAGTATTACCCCACCTTCCC -3'
(R):5'- AAGAGTCCCAGGGTCTTTCATGC -3'
Posted On2018-11-28