Incidental Mutation 'R6966:Olfr798'
ID542011
Institutional Source Beutler Lab
Gene Symbol Olfr798
Ensembl Gene ENSMUSG00000095002
Gene Nameolfactory receptor 798
SynonymsGA_x6K02T2PULF-11304679-11303744, MOR108-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129622615-129627934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129625764 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000144716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079810] [ENSMUST00000204979]
Predicted Effect probably benign
Transcript: ENSMUST00000079810
AA Change: V99A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078739
Gene: ENSMUSG00000095002
AA Change: V99A

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204979
AA Change: V99A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144716
Gene: ENSMUSG00000095002
AA Change: V99A

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Olfr798
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr798 APN 10 129625563 missense probably damaging 1.00
IGL02866:Olfr798 APN 10 129625706 nonsense probably null
R0743:Olfr798 UTSW 10 129625843 missense probably benign 0.03
R1163:Olfr798 UTSW 10 129625647 missense possibly damaging 0.79
R1192:Olfr798 UTSW 10 129626037 missense probably benign
R1863:Olfr798 UTSW 10 129625348 missense probably damaging 0.96
R1867:Olfr798 UTSW 10 129625752 missense probably damaging 0.99
R2508:Olfr798 UTSW 10 129625915 missense probably benign
R4898:Olfr798 UTSW 10 129625599 missense probably benign 0.12
R4910:Olfr798 UTSW 10 129625807 missense probably damaging 0.98
R4988:Olfr798 UTSW 10 129626061 unclassified probably null
R5361:Olfr798 UTSW 10 129625732 missense probably damaging 1.00
R5382:Olfr798 UTSW 10 129626007 missense probably damaging 0.98
R5589:Olfr798 UTSW 10 129625450 missense probably damaging 1.00
R5693:Olfr798 UTSW 10 129625527 missense probably damaging 0.99
R5790:Olfr798 UTSW 10 129625888 missense probably damaging 1.00
R7041:Olfr798 UTSW 10 129625734 missense probably damaging 1.00
R7082:Olfr798 UTSW 10 129625765 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGTTGGAGTCACAGAAATCCAG -3'
(R):5'- ACTGGAAATCTGACCATTATTACCC -3'

Sequencing Primer
(F):5'- TCCAGTTGAAGGCCCATGATC -3'
(R):5'- GACCATTATTACCCTCACTCTGATAG -3'
Posted On2018-11-28