Incidental Mutation 'R6967:Cspg4'
ID542061
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6967 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56890136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1295 (V1295M)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035661
AA Change: V1295M

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: V1295M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik A G 7: 104,059,005 I199T probably benign Het
6430628N08Rik A G 4: 115,898,294 T97A unknown Het
Adam23 T G 1: 63,563,336 probably null Het
Adamts8 C T 9: 30,954,491 T445I probably benign Het
Ahi1 T C 10: 20,988,625 V752A probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Bicra T C 7: 15,972,205 E1437G probably damaging Het
Cdc42ep4 C T 11: 113,729,172 S131N possibly damaging Het
Ces1f G A 8: 93,267,997 P262L probably benign Het
Chrna2 A T 14: 66,150,949 probably null Het
D5Ertd579e T C 5: 36,615,756 T432A probably benign Het
Dach1 A T 14: 97,903,197 S456R probably damaging Het
Dhx37 T C 5: 125,422,167 D659G probably benign Het
Dscaml1 T C 9: 45,674,523 V586A probably damaging Het
Efhb G T 17: 53,463,168 L38I probably benign Het
Fam208b A T 13: 3,574,819 D1710E probably benign Het
Fbxw10 T C 11: 62,847,603 S108P possibly damaging Het
Fmnl2 A G 2: 53,097,332 N313S possibly damaging Het
Gga3 T C 11: 115,591,276 E172G probably damaging Het
Ggta1 A G 2: 35,402,722 V191A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hcn4 C T 9: 58,823,945 T145M unknown Het
Kirrel3 T C 9: 35,034,906 S654P probably damaging Het
Klrb1 A T 6: 128,710,523 probably null Het
Krt15 T A 11: 100,134,513 D166V probably damaging Het
Lipk T A 19: 34,040,394 Y277* probably null Het
Ly6g A C 15: 75,158,549 N49T possibly damaging Het
Ms4a4c A T 19: 11,414,827 Q4L probably benign Het
Nfya A C 17: 48,392,904 probably benign Het
Nub1 T C 5: 24,708,711 V530A probably benign Het
Ocln A T 13: 100,539,288 Y232* probably null Het
Olfr1129 A G 2: 87,575,513 N143S possibly damaging Het
Olfr1468-ps1 A G 19: 13,375,451 H163R unknown Het
Olfr456 A G 6: 42,487,013 F60S probably damaging Het
Olfr462 C T 11: 87,889,498 V133I probably benign Het
Otogl G A 10: 107,814,050 A1148V probably benign Het
Paqr5 C T 9: 61,972,831 W46* probably null Het
Psd2 C A 18: 35,980,332 L286M probably damaging Het
Ptpn4 A T 1: 119,684,581 Y27* probably null Het
Ripk2 A G 4: 16,158,275 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sbk2 C T 7: 4,964,147 probably null Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sspo A C 6: 48,489,794 D4072A probably benign Het
St6galnac3 T C 3: 153,206,708 Y214C probably damaging Het
Sugp1 T A 8: 70,060,552 D256E possibly damaging Het
Sugt1 A G 14: 79,597,407 Y90C probably benign Het
Taok2 A G 7: 126,870,392 I1088T probably damaging Het
Tmc7 T A 7: 118,547,678 T459S probably benign Het
Tmed11 T C 5: 108,778,914 Y164C probably damaging Het
Tmem63b T C 17: 45,666,632 E356G probably benign Het
Ttc13 T C 8: 124,688,618 I261V probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn1r73 A T 7: 11,756,617 K121* probably null Het
Zc3h12d A T 10: 7,839,880 S16C probably damaging Het
Zfp292 A T 4: 34,807,812 M1744K probably damaging Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCCTCTTGTGGTATATAGTG -3'
(R):5'- CTCCACAGAGATGCCTTCAAG -3'

Sequencing Primer
(F):5'- TGTCAGCTATAGCAGATCCTGAGC -3'
(R):5'- TTCAAGAGGATCACCCAGGC -3'
Posted On2018-11-28