Incidental Mutation 'R6968:Chrna6'
ID542110
Institutional Source Beutler Lab
Gene Symbol Chrna6
Ensembl Gene ENSMUSG00000031491
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 6
SynonymsAcra6, alpha6 nAChR
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location27403212-27413944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27406655 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 398 (C398Y)
Ref Sequence ENSEMBL: ENSMUSP00000033882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033882]
Predicted Effect probably benign
Transcript: ENSMUST00000033882
AA Change: C398Y

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000033882
Gene: ENSMUSG00000031491
AA Change: C398Y

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 34 240 1.7e-78 PFAM
Pfam:Neur_chan_memb 247 483 1.2e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha subunit of neuronal nicotinic acetylcholine receptors. These receptors consist of five subunits and function as ion channels involved in neurotransmission. The encoded protein is a subunit of neuronal nicotinic acetylcholine receptors that mediate dopaminergic neurotransmission and are activated by acetylcholine and exogenous nicotine. Alternatively spliced transcript variants have been observed for this gene. Single nucleotide polymorphisms in this gene have been associated with both nicotine and alcohol dependence. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homzygous mutant animals have decreased numbers of high affinity binding sites for [3H]nicotine, [3H]epibaditine, and [3H]cytisine in the terminal region of the retinal ganglion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Chrna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Chrna6 APN 8 27406532 missense probably damaging 1.00
IGL02040:Chrna6 APN 8 27407261 missense probably damaging 0.99
IGL02067:Chrna6 APN 8 27404396 missense probably damaging 1.00
IGL02674:Chrna6 APN 8 27406851 missense probably benign 0.00
IGL03011:Chrna6 APN 8 27413654 missense possibly damaging 0.48
R0087:Chrna6 UTSW 8 27406986 missense probably damaging 1.00
R0421:Chrna6 UTSW 8 27408387 missense probably null 0.98
R0786:Chrna6 UTSW 8 27408380 missense probably benign 0.26
R1784:Chrna6 UTSW 8 27406784 missense possibly damaging 0.60
R1834:Chrna6 UTSW 8 27407214 missense probably benign 0.04
R2087:Chrna6 UTSW 8 27407127 missense probably benign 0.00
R4545:Chrna6 UTSW 8 27406683 missense probably benign
R4785:Chrna6 UTSW 8 27407106 missense probably damaging 1.00
R5621:Chrna6 UTSW 8 27407040 missense probably damaging 1.00
R6002:Chrna6 UTSW 8 27406746 missense probably benign 0.03
R6834:Chrna6 UTSW 8 27408310 splice site probably null
R6937:Chrna6 UTSW 8 27407027 missense probably damaging 1.00
R7303:Chrna6 UTSW 8 27406991 nonsense probably null
R7319:Chrna6 UTSW 8 27406787 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTGACTAGTCTCTAAAGTGCCTG -3'
(R):5'- AGACCATCTTCCTTCAGGCC -3'

Sequencing Primer
(F):5'- GAGAAAAGGGCTCCACTTTTAC -3'
(R):5'- CTTCCCCTCGATTCTGATGATGAGG -3'
Posted On2018-11-28