Incidental Mutation 'R6968:Sema3f'
ID542117
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
SynonymsSema IV, Semak
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6968 (G1)
Quality Score184.009
Status Not validated
Chromosome9
Chromosomal Location107681500-107710475 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 107691449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080560] [ENSMUST00000192727] [ENSMUST00000192783] [ENSMUST00000193108] [ENSMUST00000194039]
Predicted Effect probably benign
Transcript: ENSMUST00000080560
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192727
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192783
SMART Domains Protein: ENSMUSP00000141668
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
Sema 1 276 3.6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193108
SMART Domains Protein: ENSMUSP00000141878
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 191 9.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194039
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194424
Predicted Effect probably benign
Transcript: ENSMUST00000195023
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107685522 missense probably benign 0.44
IGL01940:Sema3f APN 9 107683697 unclassified probably benign
IGL02070:Sema3f APN 9 107692241 missense probably damaging 1.00
IGL02381:Sema3f APN 9 107692395 missense probably damaging 1.00
IGL02472:Sema3f APN 9 107687736 missense probably damaging 1.00
IGL02557:Sema3f APN 9 107687212 missense probably damaging 1.00
IGL02614:Sema3f APN 9 107682511 missense probably benign 0.28
IGL02660:Sema3f APN 9 107683984 missense probably benign 0.05
R1468:Sema3f UTSW 9 107687572 unclassified probably benign
R1905:Sema3f UTSW 9 107684376 missense probably damaging 1.00
R4728:Sema3f UTSW 9 107705440 missense probably benign 0.00
R4772:Sema3f UTSW 9 107689720 nonsense probably null
R4786:Sema3f UTSW 9 107682682 missense probably benign 0.45
R4845:Sema3f UTSW 9 107685501 missense probably damaging 1.00
R5418:Sema3f UTSW 9 107692621 missense probably damaging 1.00
R5780:Sema3f UTSW 9 107682589 missense probably damaging 0.98
R5849:Sema3f UTSW 9 107682616 missense probably damaging 0.98
R5929:Sema3f UTSW 9 107692193 missense probably damaging 1.00
R7043:Sema3f UTSW 9 107691400 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTCAGAACCTGAGGGCACTG -3'
(R):5'- TGAGCCAATCCTGTGTGTATG -3'

Sequencing Primer
(F):5'- CATGAGGGTATAGGGAGACATTG -3'
(R):5'- CCAATCCTGTGTGTATGTGTGTGTAC -3'
Posted On2018-11-28