Incidental Mutation 'R6968:Ppp1r13b'
ID542133
Institutional Source Beutler Lab
Gene Symbol Ppp1r13b
Ensembl Gene ENSMUSG00000021285
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13B
SynonymsASPP1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111828457-111908110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111833178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 722 (V722F)
Ref Sequence ENSEMBL: ENSMUSP00000152424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021714] [ENSMUST00000054815] [ENSMUST00000220486] [ENSMUST00000221375] [ENSMUST00000222843]
Predicted Effect probably benign
Transcript: ENSMUST00000021714
SMART Domains Protein: ENSMUSP00000021714
Gene: ENSMUSG00000021286

DomainStartEndE-ValueType
FYVE 36 105 7.11e-16 SMART
Pfam:ZFYVE21_C 108 233 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054815
AA Change: V845F

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062464
Gene: ENSMUSG00000021285
AA Change: V845F

DomainStartEndE-ValueType
PDB:2UWQ|A 1 83 8e-35 PDB
Blast:RA 5 84 3e-47 BLAST
coiled coil region 123 305 N/A INTRINSIC
low complexity region 437 476 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
PDB:4IRV|H 695 741 1e-12 PDB
ANK 917 946 4.16e-7 SMART
ANK 950 979 4.63e-5 SMART
SH3 1019 1077 1.79e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220486
AA Change: V722F

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000221375
Predicted Effect probably benign
Transcript: ENSMUST00000222843
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants show lymphatic vascular phenotypes with subcutaneous edema detected only during embryogenesis, delayed lymphatic vessel formation, and mispatterned collecting lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Ppp1r13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ppp1r13b APN 12 111829370 missense probably damaging 0.99
IGL01102:Ppp1r13b APN 12 111833219 missense probably benign
IGL01621:Ppp1r13b APN 12 111835092 missense possibly damaging 0.50
IGL01677:Ppp1r13b APN 12 111843665 missense probably benign 0.18
IGL01720:Ppp1r13b APN 12 111858260 missense probably benign 0.05
IGL01921:Ppp1r13b APN 12 111833237 missense probably benign
IGL02059:Ppp1r13b APN 12 111833347 missense probably damaging 1.00
IGL02187:Ppp1r13b APN 12 111835038 missense probably damaging 0.99
IGL02262:Ppp1r13b APN 12 111835211 missense possibly damaging 0.88
IGL02385:Ppp1r13b APN 12 111835043 missense probably damaging 1.00
IGL02894:Ppp1r13b APN 12 111831454 unclassified probably benign
IGL03027:Ppp1r13b APN 12 111830396 nonsense probably null
IGL03049:Ppp1r13b APN 12 111833229 missense probably benign 0.29
PIT4468001:Ppp1r13b UTSW 12 111838702 missense probably benign 0.08
PIT4472001:Ppp1r13b UTSW 12 111832640 missense probably damaging 1.00
R0393:Ppp1r13b UTSW 12 111835688 missense probably benign 0.01
R0561:Ppp1r13b UTSW 12 111866446 missense probably damaging 1.00
R1067:Ppp1r13b UTSW 12 111835116 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1512:Ppp1r13b UTSW 12 111872408 missense possibly damaging 0.84
R1563:Ppp1r13b UTSW 12 111840982 missense probably damaging 1.00
R1918:Ppp1r13b UTSW 12 111834810 missense probably damaging 1.00
R2014:Ppp1r13b UTSW 12 111833788 missense probably benign
R2134:Ppp1r13b UTSW 12 111833733 missense probably benign 0.00
R2306:Ppp1r13b UTSW 12 111844893 missense probably damaging 1.00
R3508:Ppp1r13b UTSW 12 111872367 missense probably damaging 1.00
R3767:Ppp1r13b UTSW 12 111846417 missense probably damaging 0.99
R4237:Ppp1r13b UTSW 12 111838736 missense probably benign
R4278:Ppp1r13b UTSW 12 111830384 missense probably damaging 0.96
R4690:Ppp1r13b UTSW 12 111832558 missense probably damaging 1.00
R4702:Ppp1r13b UTSW 12 111833281 missense probably benign 0.00
R5094:Ppp1r13b UTSW 12 111843610 missense probably benign 0.00
R5250:Ppp1r13b UTSW 12 111844960 missense probably benign 0.20
R5444:Ppp1r13b UTSW 12 111838688 missense probably benign
R5607:Ppp1r13b UTSW 12 111833789 missense probably benign 0.44
R5874:Ppp1r13b UTSW 12 111844989 missense probably damaging 1.00
R5935:Ppp1r13b UTSW 12 111830442 missense probably benign
R6074:Ppp1r13b UTSW 12 111832402 missense probably damaging 1.00
R6253:Ppp1r13b UTSW 12 111835726 missense probably benign
R6511:Ppp1r13b UTSW 12 111831567 missense probably damaging 1.00
R6836:Ppp1r13b UTSW 12 111835195 missense probably benign 0.16
R7269:Ppp1r13b UTSW 12 111834919 missense probably damaging 0.99
R7284:Ppp1r13b UTSW 12 111834966 missense possibly damaging 0.82
R7304:Ppp1r13b UTSW 12 111872406 missense possibly damaging 0.49
R7314:Ppp1r13b UTSW 12 111846356 missense probably damaging 1.00
X0010:Ppp1r13b UTSW 12 111831459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGTATGTATTCCCAGAGATGGTCC -3'
(R):5'- CCCTTCCTCAGATGCCAATG -3'

Sequencing Primer
(F):5'- TCTCTGCAGTGTCAACAGG -3'
(R):5'- GATAATGAGTTACCTTCCCCTGAG -3'
Posted On2018-11-28