Incidental Mutation 'R6968:Nsun2'
ID542137
Institutional Source Beutler Lab
Gene Symbol Nsun2
Ensembl Gene ENSMUSG00000021595
Gene NameNOL1/NOP2/Sun domain family member 2
SynonymsMisu
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location69533746-69635780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69631290 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 562 (D562G)
Ref Sequence ENSEMBL: ENSMUSP00000135455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022087] [ENSMUST00000109699] [ENSMUST00000176485]
Predicted Effect probably benign
Transcript: ENSMUST00000022087
AA Change: D531G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022087
Gene: ENSMUSG00000021595
AA Change: D531G

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 83 209 4.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 199 376 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109699
AA Change: D597G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105321
Gene: ENSMUSG00000021595
AA Change: D597G

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 169 428 3.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176485
AA Change: D562G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135455
Gene: ENSMUSG00000021595
AA Change: D562G

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 114 240 3.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 230 399 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of intron-containing tRNA(Leu)(CAA) precursors. This modification is necessary to stabilize the anticodon-codon pairing and correctly translate the mRNA. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased body size, male sterility, and hair cycle anomalies. Additional phenotypes may include reduced body fat, skeletal, craniofacial and eye defects, abnormal erythropoiesis, and altered energy expenditure and gas, glucose, and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Nsun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Nsun2 APN 13 69623249 missense probably benign 0.01
IGL01997:Nsun2 APN 13 69623246 missense probably damaging 1.00
IGL02253:Nsun2 APN 13 69619539 missense possibly damaging 0.88
IGL03038:Nsun2 APN 13 69619584 missense probably damaging 1.00
IGL02984:Nsun2 UTSW 13 69543608 intron probably benign
PIT4494001:Nsun2 UTSW 13 69618192 critical splice donor site probably null
R0601:Nsun2 UTSW 13 69633242 missense probably benign 0.40
R0648:Nsun2 UTSW 13 69627587 missense probably damaging 1.00
R0690:Nsun2 UTSW 13 69629542 missense probably benign
R0718:Nsun2 UTSW 13 69543697 intron probably benign
R1501:Nsun2 UTSW 13 69631587 missense probably damaging 1.00
R1638:Nsun2 UTSW 13 69627586 missense probably damaging 1.00
R1678:Nsun2 UTSW 13 69627103 missense probably damaging 1.00
R1687:Nsun2 UTSW 13 69627597 missense probably damaging 1.00
R2327:Nsun2 UTSW 13 69619581 missense probably benign 0.44
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R3689:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3691:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3739:Nsun2 UTSW 13 69629638 missense probably benign
R3918:Nsun2 UTSW 13 69630680 missense probably damaging 1.00
R4065:Nsun2 UTSW 13 69612460 critical splice donor site probably null
R4231:Nsun2 UTSW 13 69619541 missense probably damaging 1.00
R4445:Nsun2 UTSW 13 69629721 splice site probably null
R4872:Nsun2 UTSW 13 69543873 intron probably benign
R5641:Nsun2 UTSW 13 69623249 missense probably benign 0.01
R5718:Nsun2 UTSW 13 69623284 missense probably benign 0.19
R5976:Nsun2 UTSW 13 69623152 splice site probably null
R6110:Nsun2 UTSW 13 69627648 missense probably benign 0.01
R6943:Nsun2 UTSW 13 69630033 missense probably damaging 1.00
R7146:Nsun2 UTSW 13 69626553 critical splice donor site probably null
X0064:Nsun2 UTSW 13 69615519 critical splice donor site probably null
Z1088:Nsun2 UTSW 13 69615465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTGAGAACCAGCTCCAG -3'
(R):5'- TCCTTAAGGACAAGGGCTGC -3'

Sequencing Primer
(F):5'- GCTCCAGAAAAGGACCATTTGTC -3'
(R):5'- CCTTGTGTGGTTCATGACTTGAC -3'
Posted On2018-11-28