Incidental Mutation 'R6968:Nrg2'
ID542143
Institutional Source Beutler Lab
Gene Symbol Nrg2
Ensembl Gene ENSMUSG00000060275
Gene Nameneuregulin 2
SynonymsNTAK, Don1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6968 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36017707-36197380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36196446 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 239 (I239V)
Ref Sequence ENSEMBL: ENSMUSP00000111378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115713]
Predicted Effect
SMART Domains Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: I59V

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 1.66e-2 SMART
Pfam:Neuregulin 403 834 1.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115713
AA Change: I239V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: I239V

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 3.76e-1 SMART
Pfam:Neuregulin 409 844 4.4e-170 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Nrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nrg2 APN 18 36021218 missense probably benign 0.00
IGL01396:Nrg2 APN 18 36045852 splice site probably benign
R0179:Nrg2 UTSW 18 36022415 missense probably benign 0.13
R0976:Nrg2 UTSW 18 36021091 missense probably benign 0.21
R1387:Nrg2 UTSW 18 36196739 missense probably damaging 1.00
R1487:Nrg2 UTSW 18 36052912 missense possibly damaging 0.69
R1746:Nrg2 UTSW 18 36021922 missense probably damaging 1.00
R1882:Nrg2 UTSW 18 36021097 missense probably damaging 1.00
R1940:Nrg2 UTSW 18 36196844 unclassified probably benign
R2090:Nrg2 UTSW 18 36018443 missense probably benign 0.00
R2183:Nrg2 UTSW 18 36196751 missense probably benign 0.11
R4664:Nrg2 UTSW 18 36052895 missense possibly damaging 0.87
R4677:Nrg2 UTSW 18 36021099 missense possibly damaging 0.92
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R5091:Nrg2 UTSW 18 36052785 missense probably damaging 1.00
R6657:Nrg2 UTSW 18 36196589 missense probably damaging 0.98
R7186:Nrg2 UTSW 18 36045920 missense probably benign 0.17
R7304:Nrg2 UTSW 18 36045941 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACACTTTGAGCCTGGTTCTCG -3'
(R):5'- AGGCGGTTCCAGCTCTAAC -3'

Sequencing Primer
(F):5'- AGCCTGGTTCTCGTTCTTACCAAG -3'
(R):5'- AGGTGCTGGACAAGTGGCC -3'
Posted On2018-11-28