Incidental Mutation 'R6970:Jarid2'
ID542209
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44902985 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 556 (P556S)
Ref Sequence ENSEMBL: ENSMUSP00000134675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect probably damaging
Transcript: ENSMUST00000044608
AA Change: P556S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: P556S

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173246
AA Change: P556S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: P556S

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173367
AA Change: P417S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: P417S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173704
AA Change: P556S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: P556S

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: P518S

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GTCTCTGCTGAATGGACACG -3'
(R):5'- ATGTGCTGGATCTGCGTGAC -3'

Sequencing Primer
(F):5'- TCTCTGCTGAATGGACACGTGAAG -3'
(R):5'- TGACAAAGCGCATCTCATCGTTG -3'
Posted On2018-11-28