Incidental Mutation 'R6971:Hectd1'
ID542264
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 51748743 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 2301 (L2301*)
Ref Sequence ENSEMBL: ENSMUSP00000136449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265] [ENSMUST00000218820]
Predicted Effect probably null
Transcript: ENSMUST00000042052
AA Change: L2296*
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: L2296*

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179265
AA Change: L2301*
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: L2301*

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGGCTCTGTGAGGATTTAC -3'
(R):5'- TCATGTGGACTGTTCACAGCG -3'

Sequencing Primer
(F):5'- CTGGCTCTGTGAGGATTTACTAGTTC -3'
(R):5'- TTCCCACAGGACAGTGATGAGC -3'
Posted On2018-11-28