Incidental Mutation 'R0607:Mdn1'
ID54235
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 038796-MU
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R0607 (G1)
Quality Score162
Status Not validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32732829 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3076 (D3076E)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably benign
Transcript: ENSMUST00000071642
AA Change: D3076E

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: D3076E

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150934
Predicted Effect probably benign
Transcript: ENSMUST00000178134
AA Change: D3076E

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: D3076E

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 146 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,554,698 E146G probably benign Het
4930435E12Rik A C 16: 38,828,364 S128A probably benign Het
Abca4 G A 3: 122,156,432 G594S probably damaging Het
Acacb T C 5: 114,200,301 Y726H probably damaging Het
Adam20 T A 8: 40,795,480 M209K probably benign Het
Adam29 A G 8: 55,873,275 V48A probably damaging Het
Adss A G 1: 177,767,687 V429A possibly damaging Het
Aff1 T C 5: 103,828,454 S481P probably damaging Het
Akr1c19 G A 13: 4,238,460 A146T probably benign Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ankmy1 T G 1: 92,888,675 Y239S probably damaging Het
Ankrd24 G T 10: 81,638,308 C19F probably damaging Het
Apaf1 T C 10: 91,009,203 H1002R probably damaging Het
Apc2 T C 10: 80,314,101 I1663T probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atl3 T C 19: 7,529,666 probably null Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Cacna1a A G 8: 84,629,831 D1901G probably damaging Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cdh18 T C 15: 23,410,790 Y454H probably benign Het
Celf5 G A 10: 81,466,005 T317I probably damaging Het
Celsr2 A T 3: 108,403,895 probably null Het
Cenpf A T 1: 189,682,463 probably null Het
Cep350 T C 1: 155,872,048 D2042G probably damaging Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chgb A G 2: 132,793,335 H399R probably benign Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Col15a1 A G 4: 47,282,654 N777S probably damaging Het
Coq6 A G 12: 84,368,638 D145G possibly damaging Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp4x1 T A 4: 115,112,826 D368V probably damaging Het
D10Wsu102e T C 10: 83,362,097 S56P probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
D6Ertd527e A C 6: 87,111,905 D350A unknown Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dgka A G 10: 128,720,469 probably null Het
Dhx38 A T 8: 109,558,943 D419E probably benign Het
Dlg1 C A 16: 31,665,580 Q9K probably benign Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Egfl7 C T 2: 26,589,440 T68I probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Entpd3 A G 9: 120,557,405 T151A possibly damaging Het
Ero1lb A G 13: 12,574,866 D50G probably damaging Het
Fam219a A G 4: 41,520,242 *169Q probably null Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gja1 A G 10: 56,388,070 Y175C possibly damaging Het
Gm5478 T A 15: 101,644,624 I338F probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
Grk3 C T 5: 112,920,053 E537K probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Hcrtr2 A G 9: 76,230,684 L383P probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ikbke A T 1: 131,270,184 probably null Het
Il1r2 A G 1: 40,105,455 K101E probably benign Het
Itga11 A T 9: 62,774,371 H1054L probably benign Het
Kif13a A T 13: 46,802,711 V539D probably damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl28 A G 12: 64,951,755 Y322H probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Krt86 T A 15: 101,479,531 C479S unknown Het
Lama2 C T 10: 27,189,131 R1179H probably benign Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lcn11 T C 2: 25,779,293 V154A probably benign Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc49 C T 9: 60,666,357 V281I probably benign Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Med6 A T 12: 81,589,024 L27H probably damaging Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Myo9a T A 9: 59,921,793 M2376K probably benign Het
Nell2 G A 15: 95,229,214 T760I probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Npr3 T A 15: 11,845,282 K501N probably benign Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Oacyl A T 18: 65,747,891 Q592L possibly damaging Het
Olfr1061 T A 2: 86,413,170 N294I probably damaging Het
Olfr1243 A G 2: 89,528,107 V101A possibly damaging Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1484 T A 19: 13,586,170 Y289N probably damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Olfr813 T G 10: 129,857,201 S228A possibly damaging Het
Olfr827 T C 10: 130,211,070 E20G probably benign Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Polr2b T C 5: 77,313,159 probably benign Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdm11 G T 2: 93,013,785 D33E possibly damaging Het
Prkdc A G 16: 15,772,057 S2595G probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prrc2b G T 2: 32,213,870 R1120L probably damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Raph1 A T 1: 60,525,869 L153Q probably damaging Het
Reck A G 4: 43,940,719 T843A probably benign Het
Rgs7bp T C 13: 104,967,102 N164D probably benign Het
Rpusd4 C A 9: 35,267,993 A35D possibly damaging Het
Setd1b T C 5: 123,159,951 probably benign Het
Siglec15 G T 18: 78,046,137 D297E probably benign Het
Skint7 T A 4: 111,977,459 C13* probably null Het
Slc5a12 A G 2: 110,632,743 M395V probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srgap3 A T 6: 112,723,119 V966E probably damaging Het
Stk4 C T 2: 164,098,542 P266L probably damaging Het
Stxbp5l G A 16: 37,142,432 H754Y probably benign Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Tas2r136 T C 6: 132,777,412 I251V probably benign Het
Tecpr1 C T 5: 144,212,590 V340M probably damaging Het
Tecta C T 9: 42,388,205 G196S probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Timeless T C 10: 128,246,334 V577A probably benign Het
Tln1 A T 4: 43,553,071 V340E probably damaging Het
Tmem132c T A 5: 127,563,553 Y929* probably null Het
Tmprss7 C T 16: 45,669,551 R436Q probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Trpm6 C A 19: 18,872,221 T1704N probably benign Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttc22 T C 4: 106,639,313 V520A possibly damaging Het
Ttc3 T A 16: 94,456,785 Y1650* probably null Het
Vmn2r24 A G 6: 123,786,934 T257A probably benign Het
Xab2 A C 8: 3,613,605 N408K probably benign Het
Zbtb42 A T 12: 112,680,627 Y412F probably benign Het
Zfp282 A G 6: 47,880,369 N179D probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACAGCTCGACAGTTTCGTCAG -3'
(R):5'- TGTGGGGACAAGACACAGCATTTAC -3'

Sequencing Primer
(F):5'- CTCGACAGTTTCGTCAGTTTTG -3'
(R):5'- aaaaaaaaaaaccaaaaaaCTTCCCC -3'
Posted On2013-07-11