Incidental Mutation 'R6975:Il23r'
ID542411
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6975 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67423368 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 659 (K659N)
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect probably damaging
Transcript: ENSMUST00000118364
AA Change: K659N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: K659N

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTACAAACTGAGCTGTACTGTAC -3'
(R):5'- TCGTTTTGCAAAGTGACTCACC -3'

Sequencing Primer
(F):5'- CACCTTTAATCCTAGCACTTGGGAAG -3'
(R):5'- TTTGCAAAGTGACTCACCCAGTG -3'
Posted On2018-11-28