Incidental Mutation 'R6975:Aplf'
ID542412
Institutional Source Beutler Lab
Gene Symbol Aplf
Ensembl Gene ENSMUSG00000030051
Gene Nameaprataxin and PNKP like factor
Synonyms2010301N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6975 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location87628424-87672193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87646086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 358 (D358G)
Ref Sequence ENSEMBL: ENSMUSP00000032130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032130] [ENSMUST00000065997] [ENSMUST00000203209]
Predicted Effect probably damaging
Transcript: ENSMUST00000032130
AA Change: D358G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032130
Gene: ENSMUSG00000030051
AA Change: D358G

DomainStartEndE-ValueType
SCOP:d1lgpa_ 6 105 2e-11 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
Pfam:zf-CCHH 372 396 1.7e-16 PFAM
Pfam:zf-CCHH 414 437 6.8e-15 PFAM
low complexity region 456 471 N/A INTRINSIC
low complexity region 477 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065997
AA Change: D337G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066232
Gene: ENSMUSG00000030051
AA Change: D337G

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 84 7e-6 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
Pfam:zf-CCHH 351 376 1.7e-15 PFAM
Pfam:zf-CCHH 393 417 1.9e-15 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 456 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203209
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased repair of gamma irradiation-induced DNA damage and increased microhomology at class switch recombination junctions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Aplf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Aplf APN 6 87668408 splice site probably benign
IGL01304:Aplf APN 6 87641900 missense possibly damaging 0.71
IGL02267:Aplf APN 6 87658964 missense probably damaging 1.00
R0294:Aplf UTSW 6 87646245 missense probably benign 0.02
R0352:Aplf UTSW 6 87653884 missense probably benign 0.01
R0445:Aplf UTSW 6 87663752 missense probably damaging 1.00
R0959:Aplf UTSW 6 87646083 missense probably benign 0.24
R1127:Aplf UTSW 6 87646291 missense probably benign 0.00
R1583:Aplf UTSW 6 87646033 missense probably damaging 1.00
R2878:Aplf UTSW 6 87668427 nonsense probably null
R3617:Aplf UTSW 6 87671883 missense possibly damaging 0.85
R4708:Aplf UTSW 6 87663757 missense probably damaging 1.00
R4823:Aplf UTSW 6 87646255 missense probably damaging 1.00
R4919:Aplf UTSW 6 87630064 missense possibly damaging 0.94
R4941:Aplf UTSW 6 87668423 missense probably damaging 1.00
R4941:Aplf UTSW 6 87646349 missense probably benign 0.00
R5208:Aplf UTSW 6 87642026 splice site probably null
R5575:Aplf UTSW 6 87646147 missense probably benign 0.02
R6271:Aplf UTSW 6 87646248 missense possibly damaging 0.88
R6381:Aplf UTSW 6 87658977 missense probably damaging 0.96
R6772:Aplf UTSW 6 87663799 missense possibly damaging 0.76
R6906:Aplf UTSW 6 87630086 missense possibly damaging 0.65
R7015:Aplf UTSW 6 87641902 missense probably damaging 0.99
R7038:Aplf UTSW 6 87653823 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCCCATTGCATCCTAAAAG -3'
(R):5'- ATAGAGGAACTTGGTGAGGTCTC -3'

Sequencing Primer
(F):5'- CTAAAAGCTTCTGGCCGGACTTAG -3'
(R):5'- TGGTGAGGTCTCTAAACATAAAGCC -3'
Posted On2018-11-28