Incidental Mutation 'R6975:Gm6871'
List |< first << previous [record 83 of 217] next >> last >|
ID542416
Institutional Source Beutler Lab
Gene Symbol Gm6871
Ensembl Gene ENSMUSG00000090744
Gene Namepredicted gene 6871
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6975 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41545674-41573662 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to C at 41546778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073410] [ENSMUST00000110214] [ENSMUST00000164677]
Predicted Effect silent
Transcript: ENSMUST00000073410
SMART Domains Protein: ENSMUSP00000073117
Gene: ENSMUSG00000090744

DomainStartEndE-ValueType
KRAB 4 64 1.19e-16 SMART
ZnF_C2H2 131 153 3.44e-4 SMART
ZnF_C2H2 159 181 5.99e-4 SMART
ZnF_C2H2 187 209 3.34e-2 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 1.28e-3 SMART
ZnF_C2H2 271 293 3.69e-4 SMART
ZnF_C2H2 299 321 1.36e-2 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 3.16e-3 SMART
ZnF_C2H2 411 433 5.14e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000110214
SMART Domains Protein: ENSMUSP00000105843
Gene: ENSMUSG00000090744

DomainStartEndE-ValueType
KRAB 111 171 1.19e-16 SMART
ZnF_C2H2 238 260 3.44e-4 SMART
ZnF_C2H2 266 288 5.99e-4 SMART
ZnF_C2H2 294 316 3.34e-2 SMART
ZnF_C2H2 322 344 5.99e-4 SMART
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 3.21e-4 SMART
ZnF_C2H2 462 484 2.61e-4 SMART
ZnF_C2H2 490 512 3.16e-3 SMART
ZnF_C2H2 518 540 5.14e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000131240
Gene: ENSMUSG00000090744
AA Change: E29G

DomainStartEndE-ValueType
internal_repeat_1 21 67 6.62e-7 PROSPERO
internal_repeat_1 105 151 6.62e-7 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Gm6871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gm6871 APN 7 41546421 missense possibly damaging 0.67
R0419:Gm6871 UTSW 7 41573445 missense probably benign 0.00
R1005:Gm6871 UTSW 7 41546258 missense probably damaging 1.00
R1544:Gm6871 UTSW 7 41546090 unclassified probably null
R1553:Gm6871 UTSW 7 41546398 missense probably benign 0.00
R1674:Gm6871 UTSW 7 41573635 missense possibly damaging 0.46
R1710:Gm6871 UTSW 7 41546477 missense probably damaging 1.00
R1743:Gm6871 UTSW 7 41546452 missense probably damaging 0.98
R1777:Gm6871 UTSW 7 41545719 missense probably benign 0.23
R1844:Gm6871 UTSW 7 41573468 missense probably benign 0.03
R2508:Gm6871 UTSW 7 41547990 missense probably benign 0.11
R2966:Gm6871 UTSW 7 41573440 missense probably benign 0.07
R3155:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3156:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3967:Gm6871 UTSW 7 41546724 missense probably damaging 0.99
R4156:Gm6871 UTSW 7 41546086 missense probably damaging 0.96
R4238:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4239:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4240:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4731:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4732:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4733:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4910:Gm6871 UTSW 7 41573592 missense probably benign 0.03
R5269:Gm6871 UTSW 7 41548101 missense probably damaging 0.99
R5371:Gm6871 UTSW 7 41573568 missense probably benign 0.07
R6222:Gm6871 UTSW 7 41546582 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTCCAGTATGTGTTCTTTTATGCA -3'
(R):5'- GGGAACACCAAGACTGTGAACA -3'

Sequencing Primer
(F):5'- GTGATGTGCAAAGGCTTTACCAC -3'
(R):5'- CACCAAGACTGTGAACAATGTG -3'
Posted On2018-11-28