Incidental Mutation 'R6977:Fbxl4'
ID542495
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22376930 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 122 (Q122L)
Ref Sequence ENSEMBL: ENSMUSP00000138841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect probably benign
Transcript: ENSMUST00000039234
AA Change: Q122L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: Q122L

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184455
AA Change: Q122L

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000184582
AA Change: Q122L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: Q122L

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185029
AA Change: Q122L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410
AA Change: Q122L

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 intron probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTGGTGGATTTCAGTTCCC -3'
(R):5'- GACCAGCTCAGCCTTCTATC -3'

Sequencing Primer
(F):5'- GTTCCCATTACGGCAGTGAGAAC -3'
(R):5'- CACGACCTGGGTCACTAAGAATG -3'
Posted On2018-11-28