Incidental Mutation 'R6978:Nup210l'
ID542552
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Namenucleoporin 210-like
Synonyms4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R6978 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90104132-90212048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90154566 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 684 (R684Q)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029548
AA Change: R684Q

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: R684Q

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200410
AA Change: R684Q

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: R684Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Arhgap45 G T 10: 80,021,848 V211F probably benign Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Mchr1 T C 15: 81,237,796 L249P possibly damaging Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Vmn2r56 C T 7: 12,715,406 V302I probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zfp395 G A 14: 65,386,433 R117H probably benign Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 intron probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAAAGGCATGGTAGGACACATTG -3'
(R):5'- GAATATTACAGGTTGCAGCGTC -3'

Sequencing Primer
(F):5'- CATGGTAGGACACATTGGTAATCC -3'
(R):5'- CAGGTTGCAGCGTCATACTAATG -3'
Posted On2018-11-28