Incidental Mutation 'R6978:Vmn2r56'
ID542561
Institutional Source Beutler Lab
Gene Symbol Vmn2r56
Ensembl Gene ENSMUSG00000090762
Gene Namevomeronasal 2, receptor 56
SynonymsEG629079
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6978 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12693998-12733105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12715406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 302 (V302I)
Ref Sequence ENSEMBL: ENSMUSP00000129566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163852]
Predicted Effect probably benign
Transcript: ENSMUST00000163852
AA Change: V302I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129566
Gene: ENSMUSG00000090762
AA Change: V302I

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 1.9e-55 PFAM
Pfam:NCD3G 439 492 6.4e-20 PFAM
Pfam:7tm_3 523 760 1.3e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Arhgap45 G T 10: 80,021,848 V211F probably benign Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Mchr1 T C 15: 81,237,796 L249P possibly damaging Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Nup210l G A 3: 90,154,566 R684Q possibly damaging Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zfp395 G A 14: 65,386,433 R117H probably benign Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Vmn2r56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Vmn2r56 APN 7 12715499 missense probably benign 0.38
IGL01060:Vmn2r56 APN 7 12713089 missense probably damaging 0.97
IGL01433:Vmn2r56 APN 7 12715614 missense probably benign
IGL01859:Vmn2r56 APN 7 12716005 missense probably damaging 1.00
IGL01874:Vmn2r56 APN 7 12715675 missense probably benign 0.03
IGL02208:Vmn2r56 APN 7 12715481 missense probably benign 0.01
PIT4445001:Vmn2r56 UTSW 7 12715226 critical splice donor site probably null
R0077:Vmn2r56 UTSW 7 12715405 missense probably benign 0.01
R0278:Vmn2r56 UTSW 7 12715717 missense probably damaging 0.99
R0512:Vmn2r56 UTSW 7 12715423 missense probably benign
R0658:Vmn2r56 UTSW 7 12710308 missense probably benign 0.10
R0789:Vmn2r56 UTSW 7 12732835 missense probably damaging 1.00
R1534:Vmn2r56 UTSW 7 12694027 missense probably benign
R1731:Vmn2r56 UTSW 7 12733045 missense probably benign
R1817:Vmn2r56 UTSW 7 12715615 missense probably benign
R2047:Vmn2r56 UTSW 7 12732991 missense probably damaging 1.00
R2139:Vmn2r56 UTSW 7 12712963 nonsense probably null
R2160:Vmn2r56 UTSW 7 12694219 missense probably benign 0.43
R2449:Vmn2r56 UTSW 7 12694155 missense possibly damaging 0.67
R2877:Vmn2r56 UTSW 7 12711027 missense probably benign
R2878:Vmn2r56 UTSW 7 12711027 missense probably benign
R4910:Vmn2r56 UTSW 7 12715535 missense possibly damaging 0.64
R5072:Vmn2r56 UTSW 7 12694056 missense probably benign 0.40
R5340:Vmn2r56 UTSW 7 12715872 missense probably damaging 1.00
R5697:Vmn2r56 UTSW 7 12715990 missense probably damaging 1.00
R5798:Vmn2r56 UTSW 7 12712965 missense probably benign 0.00
R6166:Vmn2r56 UTSW 7 12694020 missense probably damaging 1.00
R6290:Vmn2r56 UTSW 7 12694882 missense probably damaging 1.00
R6458:Vmn2r56 UTSW 7 12694057 missense probably damaging 0.99
R6751:Vmn2r56 UTSW 7 12694792 missense probably benign
R7090:Vmn2r56 UTSW 7 12715327 missense probably damaging 1.00
R7200:Vmn2r56 UTSW 7 12710332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCCTGGGAGTTTGTACC -3'
(R):5'- GTGTGGGTCAGCAAAGACAC -3'

Sequencing Primer
(F):5'- AAGTCCTGGGAGTTTGTACCTTTCC -3'
(R):5'- ATACCAGGCATTTCCCAGGTG -3'
Posted On2018-11-28