Incidental Mutation 'R6982:Spata21'
ID542721
Institutional Source Beutler Lab
Gene Symbol Spata21
Ensembl Gene ENSMUSG00000045004
Gene Namespermatogenesis associated 21
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141088333-141112760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141096873 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 149 (N149I)
Ref Sequence ENSEMBL: ENSMUSP00000053080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051907
AA Change: N149I

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053080
Gene: ENSMUSG00000045004
AA Change: N149I

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 245 251 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
SCOP:d1mr8a_ 428 494 7e-13 SMART
PDB:2RRT|A 432 494 2e-7 PDB
low complexity region 524 540 N/A INTRINSIC
Meta Mutation Damage Score 0.0448 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spink5 T C 18: 44,010,042 probably null Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Spata21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Spata21 APN 4 141111364 unclassified probably null
IGL02679:Spata21 APN 4 141111265 unclassified probably benign
R1772:Spata21 UTSW 4 141111296 missense possibly damaging 0.79
R1894:Spata21 UTSW 4 141111381 missense possibly damaging 0.53
R1950:Spata21 UTSW 4 141111405 missense probably damaging 0.99
R2015:Spata21 UTSW 4 141107329 nonsense probably null
R2093:Spata21 UTSW 4 141096966 missense probably benign 0.04
R2911:Spata21 UTSW 4 141103082 missense possibly damaging 0.46
R4809:Spata21 UTSW 4 141097120 critical splice donor site probably null
R4897:Spata21 UTSW 4 141104950 missense probably damaging 0.99
R4907:Spata21 UTSW 4 141097121 critical splice donor site probably null
R4921:Spata21 UTSW 4 141112091 missense probably damaging 1.00
R5269:Spata21 UTSW 4 141103021 missense probably damaging 1.00
R5380:Spata21 UTSW 4 141107185 missense probably damaging 1.00
R5602:Spata21 UTSW 4 141096899 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCAGATGATAGCTCTTCTCAGG -3'
(R):5'- TCTTCTGCAGTCACCTTGGG -3'

Sequencing Primer
(F):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- CAGTCACCTTGGGCTTGG -3'
Posted On2018-11-28