Incidental Mutation 'R6983:F5'
ID542760
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164194129 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1391 (D1391V)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: D1391V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: D1391V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4689:F5 UTSW 1 164151973 unclassified probably benign
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4732:F5 UTSW 1 164181657 missense probably damaging 1.00
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4854:F5 UTSW 1 164192146 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5056:F5 UTSW 1 164192032 missense possibly damaging 0.60
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6754:F5 UTSW 1 164193763 missense probably damaging 1.00
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTCAGGTACCTCTCTCCTCAG -3'
(R):5'- TCTGGCTCCTCACTTGGAAC -3'

Sequencing Primer
(F):5'- GGTACCTCTCTCCTCAGACCAAAAC -3'
(R):5'- TGGAACAATCTCAACGTCGTCTC -3'
Posted On2018-11-28