Incidental Mutation 'R6984:Mapk8ip1'
ID542824
Institutional Source Beutler Lab
Gene Symbol Mapk8ip1
Ensembl Gene ENSMUSG00000027223
Gene Namemitogen-activated protein kinase 8 interacting protein 1
SynonymsMAPK8IP1, IB1, Jip1, mjip-2a, Prkm8ip, Skip, JIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location92383676-92401263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92386727 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 417 (S417T)
Ref Sequence ENSEMBL: ENSMUSP00000050773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050312] [ENSMUST00000054316] [ENSMUST00000111279] [ENSMUST00000111280] [ENSMUST00000191292]
PDB Structure
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform complex with a biaryl tetrazol (A-82118) [X-RAY DIFFRACTION]
Structural and functional analysis of quercetagetin, a natural JNK1 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000050312
AA Change: S417T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223
AA Change: S417T

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054316
SMART Domains Protein: ENSMUSP00000051464
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
Pfam:DUF4733 4 97 7.7e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111279
AA Change: S408T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223
AA Change: S408T

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191292
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutation of this gene results in a decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Mapk8ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mapk8ip1 APN 2 92385188 missense probably benign 0.06
IGL01538:Mapk8ip1 APN 2 92388974 critical splice donor site probably null
IGL02089:Mapk8ip1 APN 2 92385875 missense probably damaging 1.00
IGL02177:Mapk8ip1 APN 2 92386747 missense probably damaging 1.00
IGL03032:Mapk8ip1 APN 2 92386613 missense probably damaging 1.00
IGL03180:Mapk8ip1 APN 2 92386912 missense possibly damaging 0.91
R0243:Mapk8ip1 UTSW 2 92385944 missense probably damaging 1.00
R0483:Mapk8ip1 UTSW 2 92385976 splice site probably null
R0515:Mapk8ip1 UTSW 2 92387356 missense possibly damaging 0.71
R2016:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R2017:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R5141:Mapk8ip1 UTSW 2 92386765 missense probably damaging 1.00
R5858:Mapk8ip1 UTSW 2 92384972 missense probably damaging 1.00
R6194:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6243:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6244:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6245:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R7471:Mapk8ip1 UTSW 2 92389144 missense probably benign
X0023:Mapk8ip1 UTSW 2 92386601 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGTTCAGGTTCCCACACTG -3'
(R):5'- CCTCCATCAGTGAAGAGGATG -3'

Sequencing Primer
(F):5'- AGGTTCCCACACTGCTCCC -3'
(R):5'- ACTGCCTGTCATCCCCAGAG -3'
Posted On2018-11-28