Incidental Mutation 'R6984:Smox'
ID542826
Institutional Source Beutler Lab
Gene Symbol Smox
Ensembl Gene ENSMUSG00000027333
Gene Namespermine oxidase
SynonymsSMO, B130066H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location131491496-131525922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131522111 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 45 (A45V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028806] [ENSMUST00000110179] [ENSMUST00000110180] [ENSMUST00000110181] [ENSMUST00000110182] [ENSMUST00000110183] [ENSMUST00000110186] [ENSMUST00000110188] [ENSMUST00000110189] [ENSMUST00000129143] [ENSMUST00000183575] [ENSMUST00000183947]
Predicted Effect silent
Transcript: ENSMUST00000028806
SMART Domains Protein: ENSMUSP00000028806
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 7.2e-8 PFAM
Pfam:DAO 26 194 2.5e-9 PFAM
Pfam:NAD_binding_8 29 96 3.8e-18 PFAM
Pfam:Amino_oxidase 34 275 4.2e-27 PFAM
Pfam:Amino_oxidase 302 544 3.4e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110179
AA Change: A221V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105808
Gene: ENSMUSG00000027333
AA Change: A221V

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 206 4.2e-10 PFAM
Pfam:Pyr_redox_3 28 101 2.3e-8 PFAM
Pfam:NAD_binding_8 29 96 1e-18 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect silent
Transcript: ENSMUST00000110180
SMART Domains Protein: ENSMUSP00000105809
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 5e-8 PFAM
Pfam:DAO 26 196 1.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.5e-18 PFAM
Pfam:Amino_oxidase 34 272 2.2e-27 PFAM
Pfam:Amino_oxidase 277 408 3.8e-32 PFAM
Predicted Effect silent
Transcript: ENSMUST00000110181
SMART Domains Protein: ENSMUSP00000105810
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 3.6e-8 PFAM
Pfam:DAO 26 202 8.9e-10 PFAM
Pfam:NAD_binding_8 29 96 1.2e-18 PFAM
Pfam:Amino_oxidase 34 116 2.1e-22 PFAM
Pfam:Amino_oxidase 197 374 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110182
SMART Domains Protein: ENSMUSP00000105811
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.2e-6 PFAM
Pfam:FAD_binding_2 26 87 1.6e-8 PFAM
Pfam:DAO 26 183 2.9e-9 PFAM
Pfam:Pyr_redox_3 28 103 1.4e-8 PFAM
Pfam:NAD_binding_8 29 96 6.3e-19 PFAM
Pfam:Amino_oxidase 34 118 3.6e-23 PFAM
Pfam:Amino_oxidase 129 179 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110183
SMART Domains Protein: ENSMUSP00000105812
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 227 5.1e-10 PFAM
Pfam:Pyr_redox_3 28 103 2.2e-8 PFAM
Pfam:NAD_binding_8 29 96 1.1e-18 PFAM
Pfam:Amino_oxidase 34 118 6.2e-23 PFAM
Pfam:Amino_oxidase 141 237 4.5e-11 PFAM
Predicted Effect silent
Transcript: ENSMUST00000110186
SMART Domains Protein: ENSMUSP00000105815
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 78 1.7e-7 PFAM
Pfam:DAO 26 132 7.9e-9 PFAM
Pfam:NAD_binding_8 29 95 5.6e-18 PFAM
Pfam:Amino_oxidase 34 275 2.9e-28 PFAM
Pfam:Amino_oxidase 304 574 2.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110188
SMART Domains Protein: ENSMUSP00000105817
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.9e-8 PFAM
Pfam:DAO 26 194 2.4e-9 PFAM
Pfam:NAD_binding_8 29 96 3.6e-18 PFAM
Pfam:Amino_oxidase 34 275 3.8e-27 PFAM
Pfam:Amino_oxidase 302 463 2.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110189
SMART Domains Protein: ENSMUSP00000105818
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.5e-8 PFAM
Pfam:DAO 26 194 2.2e-9 PFAM
Pfam:NAD_binding_8 29 96 3.4e-18 PFAM
Pfam:Amino_oxidase 34 275 3.5e-27 PFAM
Pfam:Amino_oxidase 302 462 5.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129143
SMART Domains Protein: ENSMUSP00000120237
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 9.3e-7 PFAM
Pfam:FAD_binding_2 26 86 8.9e-9 PFAM
Pfam:DAO 26 190 1.6e-10 PFAM
Pfam:Pyr_redox_3 28 102 9.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.7e-19 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183575
SMART Domains Protein: ENSMUSP00000139099
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:Thi4 17 73 8.6e-7 PFAM
Pfam:FAD_binding_2 26 75 3.3e-9 PFAM
Pfam:DAO 26 79 4.2e-10 PFAM
Pfam:Pyr_redox 26 79 1.4e-7 PFAM
Pfam:Pyr_redox_3 28 77 2.1e-9 PFAM
Pfam:NAD_binding_8 29 80 6.8e-15 PFAM
Pfam:Amino_oxidase 34 76 3.5e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183881
AA Change: A45V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000183947
SMART Domains Protein: ENSMUSP00000139278
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.4e-6 PFAM
Pfam:FAD_binding_2 26 85 1.8e-8 PFAM
Pfam:DAO 26 200 5e-10 PFAM
Pfam:Pyr_redox_3 28 102 1.7e-8 PFAM
Pfam:NAD_binding_8 29 96 7.7e-19 PFAM
Pfam:Amino_oxidase 34 118 4.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Smox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Smox APN 2 131512059 missense possibly damaging 0.91
IGL02022:Smox APN 2 131520117 missense probably damaging 0.98
R0368:Smox UTSW 2 131522158 missense probably damaging 1.00
R0411:Smox UTSW 2 131520644 missense probably benign 0.02
R1416:Smox UTSW 2 131522131 missense probably damaging 1.00
R1601:Smox UTSW 2 131520174 missense probably damaging 1.00
R1959:Smox UTSW 2 131520464 missense probably damaging 0.97
R2173:Smox UTSW 2 131512024 missense possibly damaging 0.91
R2215:Smox UTSW 2 131520270 critical splice donor site probably null
R4179:Smox UTSW 2 131524850 missense possibly damaging 0.84
R5282:Smox UTSW 2 131521106 missense probably damaging 0.99
R5630:Smox UTSW 2 131524866 nonsense probably null
R5979:Smox UTSW 2 131516414 missense probably damaging 0.99
R6986:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7073:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7074:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7183:Smox UTSW 2 131520566 missense possibly damaging 0.91
X0026:Smox UTSW 2 131516235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGACTGCTTGATTGTCTTGAAG -3'
(R):5'- TTTCACCATGGGAGCCAACC -3'

Sequencing Primer
(F):5'- ATTGTCTTGAAGCCCAGGAG -3'
(R):5'- ATGGTGCCCTTAGTGAACAC -3'
Posted On2018-11-28