Incidental Mutation 'R6984:Asb15'
ID542834
Institutional Source Beutler Lab
Gene Symbol Asb15
Ensembl Gene ENSMUSG00000029685
Gene Nameankyrin repeat and SOCS box-containing 15
Synonyms4930400E23Rik
MMRRC Submission
Accession Numbers

Genbank: NM_080847; MGI: 1926160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location24528144-24573164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24566337 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 430 (I430F)
Ref Sequence ENSEMBL: ENSMUSP00000112965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031696] [ENSMUST00000117688]
Predicted Effect probably benign
Transcript: ENSMUST00000031696
AA Change: I430F

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031696
Gene: ENSMUSG00000029685
AA Change: I430F

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117688
AA Change: I430F

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112965
Gene: ENSMUSG00000029685
AA Change: I430F

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling box superfamily. The proteins in this superfamily participate in the ubiquitin-proteasome system for the degradation of proteins in the cell cycle and signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Asb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Asb15 APN 6 24558643 splice site probably benign
IGL00557:Asb15 APN 6 24558650 missense probably benign
IGL00694:Asb15 APN 6 24570664 missense possibly damaging 0.79
IGL01137:Asb15 APN 6 24556522 missense probably benign
IGL01681:Asb15 APN 6 24567138 missense probably damaging 0.98
IGL01691:Asb15 APN 6 24567272 missense probably benign 0.02
IGL01791:Asb15 APN 6 24567212 missense probably damaging 1.00
IGL01989:Asb15 APN 6 24565944 missense probably damaging 1.00
IGL02480:Asb15 APN 6 24570746 missense probably damaging 0.99
IGL02541:Asb15 APN 6 24566266 missense probably damaging 1.00
IGL02707:Asb15 APN 6 24558788 splice site probably benign
IGL03090:Asb15 APN 6 24567186 missense possibly damaging 0.52
IGL03331:Asb15 APN 6 24556524 missense possibly damaging 0.70
3-1:Asb15 UTSW 6 24566221 missense probably benign 0.00
R0196:Asb15 UTSW 6 24564393 missense probably damaging 0.99
R0603:Asb15 UTSW 6 24556557 missense probably damaging 1.00
R0650:Asb15 UTSW 6 24566164 missense probably damaging 1.00
R1114:Asb15 UTSW 6 24567177 missense probably damaging 1.00
R1170:Asb15 UTSW 6 24562487 splice site probably benign
R1365:Asb15 UTSW 6 24567270 missense possibly damaging 0.95
R2323:Asb15 UTSW 6 24556601 missense probably benign 0.01
R3147:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R3148:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R4762:Asb15 UTSW 6 24567237 missense possibly damaging 0.81
R4771:Asb15 UTSW 6 24570622 missense probably damaging 0.99
R4915:Asb15 UTSW 6 24566293 missense probably damaging 0.96
R5369:Asb15 UTSW 6 24562564 missense probably benign 0.00
R5415:Asb15 UTSW 6 24570691 missense probably benign 0.05
R5781:Asb15 UTSW 6 24564378 missense probably benign 0.11
R6649:Asb15 UTSW 6 24562633 missense probably benign
R6653:Asb15 UTSW 6 24562633 missense probably benign
R6781:Asb15 UTSW 6 24558675 missense probably benign
R7297:Asb15 UTSW 6 24566463 missense probably damaging 0.96
R7340:Asb15 UTSW 6 24558514 missense probably benign 0.00
R7419:Asb15 UTSW 6 24556556 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGCAGACCCCAACTTGGATC -3'
(R):5'- AGTAGCCTTGATTCCTGGGC -3'

Sequencing Primer
(F):5'- AACTTGGATCCCCTCAACTG -3'
(R):5'- CTAGAGACAGCTACATCTGGGTC -3'
Posted On2018-11-28