Incidental Mutation 'R6984:Sympk'
ID542836
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19038043 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 344 (D344G)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903] [ENSMUST00000153976]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
AA Change: D344G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: D344G

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153976
SMART Domains Protein: ENSMUSP00000121540
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Cohesin_HEAT 48 96 9e-7 PFAM
Pfam:DUF3453 117 198 2.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTGAGAACTGTCCACCGCAC -3'
(R):5'- AGACCATTTGCTCCTAGACTATTC -3'

Sequencing Primer
(F):5'- TGTCCACCGCACTGAGCTC -3'
(R):5'- ATTTGCTCCTAGACTATTCTCAAGG -3'
Posted On2018-11-28