Incidental Mutation 'R6984:Lrrc4b'
ID542837
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Nameleucine rich repeat containing 4B
SynonymsLrig4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44429018-44463351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44461298 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 198 (E198V)
Ref Sequence ENSEMBL: ENSMUSP00000119374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156093] [ENSMUST00000156957]
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000058667
AA Change: E198V

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: E198V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127790
AA Change: E198V

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085
AA Change: E198V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect possibly damaging
Transcript: ENSMUST00000156093
AA Change: E198V

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085
AA Change: E198V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156957
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44462315 missense probably damaging 0.99
R1398:Lrrc4b UTSW 7 44462452 missense probably benign 0.44
R1421:Lrrc4b UTSW 7 44461051 missense probably benign 0.00
R1622:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1681:Lrrc4b UTSW 7 44461177 missense probably damaging 0.99
R1778:Lrrc4b UTSW 7 44462399 missense probably benign
R1967:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1989:Lrrc4b UTSW 7 44462230 unclassified probably benign
R2427:Lrrc4b UTSW 7 44462552 missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R3822:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44462372 unclassified probably null
R5249:Lrrc4b UTSW 7 44462564 missense possibly damaging 0.93
R5268:Lrrc4b UTSW 7 44461363 missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44462330 missense probably benign 0.00
R7003:Lrrc4b UTSW 7 44445156 missense probably damaging 1.00
R7392:Lrrc4b UTSW 7 44462015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAACTCTTCGACAACCG -3'
(R):5'- TTGTGGGACAGGTTCAGCTC -3'

Sequencing Primer
(F):5'- TCTTCGACAACCGGCTGAC -3'
(R):5'- ACTTGGGCATGCATCAGC -3'
Posted On2018-11-28