Incidental Mutation 'R6984:Aktip'
ID542842
Institutional Source Beutler Lab
Gene Symbol Aktip
Ensembl Gene ENSMUSG00000031667
Gene Namethymoma viral proto-oncogene 1 interacting protein
SynonymsFt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location91111784-91199976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91126718 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 124 (F124I)
Ref Sequence ENSEMBL: ENSMUSP00000119277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000109609] [ENSMUST00000120213] [ENSMUST00000120349] [ENSMUST00000120426] [ENSMUST00000125257] [ENSMUST00000209311] [ENSMUST00000209444] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably benign
Transcript: ENSMUST00000034091
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109609
AA Change: F124I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105238
Gene: ENSMUSG00000031667
AA Change: F124I

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120213
AA Change: F124I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112375
Gene: ENSMUSG00000031667
AA Change: F124I

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120349
AA Change: F124I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113769
Gene: ENSMUSG00000031667
AA Change: F124I

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000113379
Gene: ENSMUSG00000031667
AA Change: F124I

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125257
AA Change: F124I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119277
Gene: ENSMUSG00000031667
AA Change: F124I

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209311
Predicted Effect probably benign
Transcript: ENSMUST00000209444
Predicted Effect probably benign
Transcript: ENSMUST00000209518
Predicted Effect probably benign
Transcript: ENSMUST00000211050
Predicted Effect probably benign
Transcript: ENSMUST00000211136
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Aktip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Aktip APN 8 91126225 missense probably damaging 1.00
IGL02351:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL02358:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL03085:Aktip APN 8 91126023 critical splice donor site probably null
R1564:Aktip UTSW 8 91131081 start codon destroyed probably null 0.94
R1809:Aktip UTSW 8 91129720 missense probably damaging 1.00
R1851:Aktip UTSW 8 91125877 missense possibly damaging 0.93
R4067:Aktip UTSW 8 91125838 missense possibly damaging 0.87
R4455:Aktip UTSW 8 91124851 missense probably benign 0.00
R5052:Aktip UTSW 8 91129651 missense possibly damaging 0.47
R5330:Aktip UTSW 8 91126724 missense probably damaging 0.98
R6134:Aktip UTSW 8 91129760 missense probably damaging 1.00
R6178:Aktip UTSW 8 91126043 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTGTGGGAGACATACATTCG -3'
(R):5'- AGCTGACTATCCTACCGCTC -3'

Sequencing Primer
(F):5'- CATTCGAGGAGACTGAGGTCATTAC -3'
(R):5'- GGAGTCTACGTACAGCCATCTTAC -3'
Posted On2018-11-28