Incidental Mutation 'R6984:Rhot1'
ID542852
Institutional Source Beutler Lab
Gene Symbol Rhot1
Ensembl Gene ENSMUSG00000017686
Gene Nameras homolog family member T1
Synonyms2210403N23Rik, Arht1, C430039G08Rik, FLJ11040, Miro1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80209019-80267907 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80233484 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 157 (C157*)
Ref Sequence ENSEMBL: ENSMUSP00000090533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017831] [ENSMUST00000055056] [ENSMUST00000077451] [ENSMUST00000092857]
Predicted Effect probably null
Transcript: ENSMUST00000017831
AA Change: C157*
SMART Domains Protein: ENSMUSP00000017831
Gene: ENSMUSG00000017686
AA Change: C157*

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.5e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.6e-16 PFAM
Pfam:Ras 433 566 1.7e-6 PFAM
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000055056
AA Change: C157*
SMART Domains Protein: ENSMUSP00000057669
Gene: ENSMUSG00000017686
AA Change: C157*

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.6e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.4e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.7e-16 PFAM
Pfam:Ras 433 577 1.6e-6 PFAM
transmembrane domain 647 669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077451
AA Change: C157*
SMART Domains Protein: ENSMUSP00000076664
Gene: ENSMUSG00000017686
AA Change: C157*

DomainStartEndE-ValueType
Pfam:Roc 19 135 9.4e-11 PFAM
Pfam:Ras 19 181 9.1e-21 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 232 318 8.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 354 426 7e-32 PFAM
Pfam:Ras 433 566 1.5e-6 PFAM
transmembrane domain 679 701 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092857
AA Change: C157*
SMART Domains Protein: ENSMUSP00000090533
Gene: ENSMUSG00000017686
AA Change: C157*

DomainStartEndE-ValueType
small_GTPase 15 182 5.1e-8 SMART
EFh 201 229 3.3e-2 SMART
Pfam:EF_assoc_2 231 319 2.9e-33 PFAM
EFh 321 349 8.1e-3 SMART
Pfam:EF_assoc_1 353 427 1e-30 PFAM
Pfam:Miro 433 543 8e-15 PFAM
Pfam:Ras 433 566 2.5e-5 PFAM
transmembrane domain 606 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele die neonatally exhibiting cyanosis, respiratory failure, loss of brainstem cranial motor neurons, decreased cervical motor neuron number and phrenic nerve branching, and alterations in retrograde mitochondrial transport and run length in cortical axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Rhot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Rhot1 APN 11 80226102 missense probably benign 0.27
IGL01335:Rhot1 APN 11 80250229 missense probably damaging 1.00
IGL01631:Rhot1 APN 11 80265774 missense probably damaging 1.00
IGL03009:Rhot1 APN 11 80220254 splice site probably null
IGL03106:Rhot1 APN 11 80242581 nonsense probably null
R0554:Rhot1 UTSW 11 80243438 nonsense probably null
R0720:Rhot1 UTSW 11 80223943 missense probably damaging 1.00
R1319:Rhot1 UTSW 11 80246021 missense probably damaging 0.98
R3825:Rhot1 UTSW 11 80226081 missense probably damaging 0.98
R4713:Rhot1 UTSW 11 80225602 missense probably benign 0.00
R4917:Rhot1 UTSW 11 80209201 utr 5 prime probably benign
R4971:Rhot1 UTSW 11 80233474 missense probably damaging 1.00
R5159:Rhot1 UTSW 11 80220272 missense probably damaging 1.00
R5177:Rhot1 UTSW 11 80246766 missense possibly damaging 0.90
R5231:Rhot1 UTSW 11 80227334 critical splice donor site probably null
R5659:Rhot1 UTSW 11 80250355 intron probably null
R5941:Rhot1 UTSW 11 80251170 intron probably benign
R6216:Rhot1 UTSW 11 80251059 missense probably benign 0.00
R6920:Rhot1 UTSW 11 80242095 missense probably benign 0.36
R7199:Rhot1 UTSW 11 80246734 missense probably damaging 1.00
R7383:Rhot1 UTSW 11 80223934 missense probably damaging 1.00
R7453:Rhot1 UTSW 11 80248540 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTGACTGAACCTACTATCTGG -3'
(R):5'- ACACATTTTCCTTTGTGGACAG -3'

Sequencing Primer
(F):5'- GCTTGACCAAGTTACGATGGG -3'
(R):5'- TTGTGGACAGTACCAAGATCTCC -3'
Posted On2018-11-28