Incidental Mutation 'R6985:Capn10'
ID542884
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Namecalpain 10
SynonymsCapn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location92934376-92947941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92943424 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 319 (Y319H)
Ref Sequence ENSEMBL: ENSMUSP00000122158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000117814] [ENSMUST00000152983]
Predicted Effect probably damaging
Transcript: ENSMUST00000027488
AA Change: Y319H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: Y319H

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117814
SMART Domains Protein: ENSMUSP00000112831
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 263 1.29e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152983
AA Change: Y319H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270
AA Change: Y319H

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1256:Capn10 UTSW 1 92946946 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1653:Capn10 UTSW 1 92946898 missense probably damaging 1.00
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R7140:Capn10 UTSW 1 92945271 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCAAAAGTTTGAGGCTCTCC -3'
(R):5'- CTGAGGTAAGCAGACCAGTG -3'

Sequencing Primer
(F):5'- AAAGTTTGAGGCTCTCCACCCC -3'
(R):5'- GACCAGTGGCAGTCAACTC -3'
Posted On2018-11-28