Incidental Mutation 'R6985:Mapkap1'
ID542886
Institutional Source Beutler Lab
Gene Symbol Mapkap1
Ensembl Gene ENSMUSG00000038696
Gene Namemitogen-activated protein kinase associated protein 1
SynonymsSin1, D230039K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location34406771-34624950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34432110 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 13 (H13Q)
Ref Sequence ENSEMBL: ENSMUSP00000141407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113123] [ENSMUST00000113124] [ENSMUST00000113126] [ENSMUST00000124443] [ENSMUST00000141253] [ENSMUST00000147337] [ENSMUST00000149383]
Predicted Effect probably benign
Transcript: ENSMUST00000113123
SMART Domains Protein: ENSMUSP00000108748
Gene: ENSMUSG00000038696

DomainStartEndE-ValueType
Pfam:SIN1 1 289 2e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113124
AA Change: H13Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108749
Gene: ENSMUSG00000038696
AA Change: H13Q

DomainStartEndE-ValueType
Pfam:SIN1 18 324 4.7e-125 PFAM
Pfam:SIN1 318 445 2.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113126
AA Change: H13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108751
Gene: ENSMUSG00000038696
AA Change: H13Q

DomainStartEndE-ValueType
Pfam:SIN1 18 481 1.1e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124443
SMART Domains Protein: ENSMUSP00000123301
Gene: ENSMUSG00000038696

DomainStartEndE-ValueType
Pfam:SIN1 1 289 1.6e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141253
AA Change: H13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000147337
AA Change: H13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116494
Gene: ENSMUSG00000038696
AA Change: H13Q

DomainStartEndE-ValueType
Pfam:SIN1 18 129 1.2e-32 PFAM
Pfam:CRIM 139 276 3.3e-38 PFAM
Pfam:SIN1_PH 381 488 3.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149383
AA Change: H13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141407
Gene: ENSMUSG00000038696
AA Change: H13Q

DomainStartEndE-ValueType
Pfam:SIN1 18 171 2.7e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality due to early developmental abnormalities. Mutant mouse embryonic fibroblasts display increased susceptibility to stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Mapkap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Mapkap1 APN 2 34518843 missense probably damaging 1.00
IGL02104:Mapkap1 APN 2 34623470 nonsense probably null
IGL02390:Mapkap1 APN 2 34432089 missense probably damaging 0.99
IGL02508:Mapkap1 APN 2 34518669 splice site probably benign
IGL02817:Mapkap1 APN 2 34563118 missense probably damaging 1.00
PIT4696001:Mapkap1 UTSW 2 34619849 missense probably damaging 0.96
R0129:Mapkap1 UTSW 2 34623482 missense probably damaging 1.00
R0480:Mapkap1 UTSW 2 34533781 splice site probably benign
R1966:Mapkap1 UTSW 2 34518679 missense probably damaging 0.98
R2167:Mapkap1 UTSW 2 34597482 missense probably damaging 1.00
R4432:Mapkap1 UTSW 2 34619863 missense probably damaging 1.00
R4789:Mapkap1 UTSW 2 34533847 missense possibly damaging 0.64
R4805:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4806:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4807:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4808:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4862:Mapkap1 UTSW 2 34623430 missense probably damaging 1.00
R4989:Mapkap1 UTSW 2 34581291 missense probably damaging 1.00
R5283:Mapkap1 UTSW 2 34444348 missense probably damaging 1.00
R6186:Mapkap1 UTSW 2 34563114 missense possibly damaging 0.76
R6248:Mapkap1 UTSW 2 34518680 missense probably damaging 1.00
R6891:Mapkap1 UTSW 2 34563141 missense probably damaging 1.00
R7078:Mapkap1 UTSW 2 34563139 missense probably damaging 1.00
R7179:Mapkap1 UTSW 2 34518700 missense possibly damaging 0.88
R7336:Mapkap1 UTSW 2 34533817 missense possibly damaging 0.51
R7392:Mapkap1 UTSW 2 34435154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAAGCTCTTGGGTACGG -3'
(R):5'- ACTGGGCGTATATGTAGCCC -3'

Sequencing Primer
(F):5'- ACGGGGATAATGATGGTTTTCAAG -3'
(R):5'- GCGTATATGTAGCCCTGCGTC -3'
Posted On2018-11-28