Incidental Mutation 'R6985:Cntn4'
List |< first << previous [record 13 of 66] next >> last >|
ID542899
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106679417 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 893 (N893S)
Ref Sequence ENSEMBL: ENSMUSP00000108889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089208] [ENSMUST00000113264]
Predicted Effect probably benign
Transcript: ENSMUST00000089208
AA Change: N893S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: N893S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113264
AA Change: N893S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: N893S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R7246:Cntn4 UTSW 6 106506219 missense probably damaging 1.00
R7282:Cntn4 UTSW 6 106525460 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATTGGAAGTCTCCCCAGTG -3'
(R):5'- GGCATGCTATTCTGAAAGGTTC -3'

Sequencing Primer
(F):5'- CTCCCCAGTGGATATAATTTCCAAGG -3'
(R):5'- GGTTCAGTTAAAATGCTAAGGTGC -3'
Posted On2018-11-28