Incidental Mutation 'R6985:Kirrel2'
ID542900
Institutional Source Beutler Lab
Gene Symbol Kirrel2
Ensembl Gene ENSMUSG00000036915
Gene Namekirre like nephrin family adhesion molecule 2
SynonymsC330019F22Rik, NEPH3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30447534-30457690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30455306 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 127 (G127C)
Ref Sequence ENSEMBL: ENSMUSP00000039395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000045817] [ENSMUST00000126297]
Predicted Effect probably benign
Transcript: ENSMUST00000006825
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045817
AA Change: G127C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039395
Gene: ENSMUSG00000036915
AA Change: G127C

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG 128 219 5.13e-1 SMART
IG_like 230 306 8.06e0 SMART
IGc2 321 379 3.06e-8 SMART
IG_like 401 500 4.65e1 SMART
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 607 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169893
SMART Domains Protein: ENSMUSP00000131161
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG_like 118 189 5.91e-1 SMART
IG_like 211 287 8.06e0 SMART
IGc2 302 360 3.06e-8 SMART
IG_like 382 481 4.65e1 SMART
transmembrane domain 490 512 N/A INTRINSIC
low complexity region 528 546 N/A INTRINSIC
low complexity region 588 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170152
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein and member of the immunoglobulin superfamily of cell adhesion molecules. The encoded protein localizes to adherens junctions in pancreatic beta cells and regulates insulin secretion. Autoantibodies against the encoded protein have been detected in serum from patients with type 1 diabetes. This gene may also play a role in glomerular development and decreased expression of this gene has been observed in human glomerular diseases. This gene and the related opposite-strand gene nephrin (GeneID: 527362) are regulated by a bidirectional promoter. [provided by RefSeq, Jul 2016]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Kirrel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Kirrel2 APN 7 30453664 missense probably benign 0.03
IGL02457:Kirrel2 APN 7 30452740 missense probably damaging 1.00
IGL02609:Kirrel2 APN 7 30448340 missense probably benign 0.00
R0029:Kirrel2 UTSW 7 30453165 unclassified probably benign
R0395:Kirrel2 UTSW 7 30450458 missense possibly damaging 0.68
R0987:Kirrel2 UTSW 7 30448130 missense probably damaging 1.00
R1511:Kirrel2 UTSW 7 30456498 missense probably damaging 1.00
R2226:Kirrel2 UTSW 7 30454154 missense probably damaging 1.00
R4818:Kirrel2 UTSW 7 30449868 missense probably benign 0.32
R4963:Kirrel2 UTSW 7 30450801 critical splice donor site probably null
R6918:Kirrel2 UTSW 7 30450814 missense probably damaging 1.00
R6995:Kirrel2 UTSW 7 30455179 missense probably damaging 1.00
R7014:Kirrel2 UTSW 7 30454574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGTTGCTGAGTCTCAATAATGAAC -3'
(R):5'- TCGTATGAGTGCCAGGCTTC -3'

Sequencing Primer
(F):5'- CAAGAATGACAAAGAGATTTAGACCC -3'
(R):5'- TTCGCAAGCAGGTCTCCGATC -3'
Posted On2018-11-28