Incidental Mutation 'R6985:Rex1bd'
List |< first << previous [record 53 of 66] next >> last >|
ID542910
Institutional Source Beutler Lab
Gene Symbol Rex1bd
Ensembl Gene ENSMUSG00000058833
Gene Namerequired for excision 1-B domain containing
Synonyms2810428I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70504292-70506752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70505905 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 71 (S71G)
Ref Sequence ENSEMBL: ENSMUSP00000120446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000081940] [ENSMUST00000121623] [ENSMUST00000124967] [ENSMUST00000125184] [ENSMUST00000129909] [ENSMUST00000132648] [ENSMUST00000135446] [ENSMUST00000136913] [ENSMUST00000138260] [ENSMUST00000140679] [ENSMUST00000165126]
Predicted Effect probably benign
Transcript: ENSMUST00000008032
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
AA Change: S71G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833
AA Change: S71G

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081940
SMART Domains Protein: ENSMUSP00000080608
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121623
SMART Domains Protein: ENSMUSP00000113804
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 14 99 3.3e-34 PFAM
UBQ 105 176 2.14e-36 SMART
Ribosomal_L40e 181 232 1.02e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124967
SMART Domains Protein: ENSMUSP00000122797
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 96 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125184
SMART Domains Protein: ENSMUSP00000120096
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127983
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129909
SMART Domains Protein: ENSMUSP00000121149
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Ribosomal_L40e 77 128 1.02e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132648
SMART Domains Protein: ENSMUSP00000119545
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
FN3 16 101 2.11e0 SMART
low complexity region 104 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135446
SMART Domains Protein: ENSMUSP00000123562
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136913
AA Change: S71G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833
AA Change: S71G

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140679
SMART Domains Protein: ENSMUSP00000123263
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165126
SMART Domains Protein: ENSMUSP00000137461
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Rex1bd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02956:Rex1bd APN 8 70505902 missense possibly damaging 0.80
R5960:Rex1bd UTSW 8 70506506 missense probably null 0.04
Predicted Primers PCR Primer
(F):5'- TGCCCCACTCTAAAAGGAGAGG -3'
(R):5'- TGTGACCCTCCACAAGATCC -3'

Sequencing Primer
(F):5'- AGAGGGGTGGTGGTCTTACC -3'
(R):5'- AAGATCCCTCATTTCTCTGAGTGCAG -3'
Posted On2018-11-28