Incidental Mutation 'R6985:Dnaja4'
ID542912
Institutional Source Beutler Lab
Gene Symbol Dnaja4
Ensembl Gene ENSMUSG00000032285
Gene NameDnaJ heat shock protein family (Hsp40) member A4
Synonyms1110021L12Rik, Hsj4, Dj4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location54698873-54716315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54708395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000119602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070070] [ENSMUST00000120452] [ENSMUST00000154690]
Predicted Effect probably benign
Transcript: ENSMUST00000070070
AA Change: V109A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070413
Gene: ENSMUSG00000032285
AA Change: V109A

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 2.1e-15 PFAM
Pfam:CTDII 258 340 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120452
AA Change: V109A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112520
Gene: ENSMUSG00000032285
AA Change: V109A

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_C 108 330 9.7e-35 PFAM
Pfam:DnaJ_CXXCXGXG 135 201 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154690
AA Change: V109A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119602
Gene: ENSMUSG00000032285
AA Change: V109A

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Dnaja4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Dnaja4 APN 9 54714510 missense possibly damaging 0.93
PIT4305001:Dnaja4 UTSW 9 54710634 missense probably benign 0.01
R2139:Dnaja4 UTSW 9 54709222 missense probably benign 0.01
R4837:Dnaja4 UTSW 9 54710644 missense probably benign 0.00
R5087:Dnaja4 UTSW 9 54699739 missense probably damaging 0.99
R5862:Dnaja4 UTSW 9 54699341 unclassified probably benign
R6722:Dnaja4 UTSW 9 54699754 missense probably damaging 0.99
R7165:Dnaja4 UTSW 9 54709232 missense probably damaging 1.00
R7228:Dnaja4 UTSW 9 54714285 missense possibly damaging 0.88
X0057:Dnaja4 UTSW 9 54699804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGGGTAGCCAGGAGTTAG -3'
(R):5'- GCTTGACTCCCACACTTGAC -3'

Sequencing Primer
(F):5'- CTCCATCTTGGCAGGGACTAGTAG -3'
(R):5'- TTGACTCCCACACTTGACAAGATGAG -3'
Posted On2018-11-28