Incidental Mutation 'R6985:Spata31d1d'
List |< first << previous [record 59 of 66] next >> last >|
ID542926
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59731615 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 36 (I36F)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect probably benign
Transcript: ENSMUST00000052978
AA Change: I36F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: I36F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59726497 missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59726400 missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7174:Spata31d1d UTSW 13 59728580 missense possibly damaging 0.72
R7322:Spata31d1d UTSW 13 59726976 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCACAGTATCGTAACAGCTCAGG -3'
(R):5'- TTCCCTGCTCTGTGATGCAG -3'

Sequencing Primer
(F):5'- AGGTACTGCGCTCAGACAG -3'
(R):5'- AGGCCTGCCCACTTACAG -3'
Posted On2018-11-28