Incidental Mutation 'R6985:Arid2'
ID542935
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96370148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 714 (V714A)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
Predicted Effect probably benign
Transcript: ENSMUST00000096250
AA Change: V714A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: V714A

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0400:Arid2 UTSW 15 96356925 unclassified probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2359:Arid2 UTSW 15 96361878 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3785:Arid2 UTSW 15 96372558 missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5620:Arid2 UTSW 15 96372506 missense probably benign 0.20
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6005:Arid2 UTSW 15 96370972 missense probably benign
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6776:Arid2 UTSW 15 96370949 missense probably benign 0.00
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGACTCCTGTCACCAATC -3'
(R):5'- GGATTACTGTGACAGGAGTGCC -3'

Sequencing Primer
(F):5'- AGGACTCCTGTCACCAATCAATCTTC -3'
(R):5'- TGCCTGAAGGGACCTGTC -3'
Posted On2018-11-28