Incidental Mutation 'R6985:Pcdhb19'
ID542940
Institutional Source Beutler Lab
Gene Symbol Pcdhb19
Ensembl Gene ENSMUSG00000043313
Gene Nameprotocadherin beta 19
SynonymsPcdhbS, Pcdhb11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37496991-37504128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37497158 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000053326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055949] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
AA Change: E2G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313
AA Change: E2G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Pcdhb19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Pcdhb19 APN 18 37497989 missense probably damaging 1.00
IGL02070:Pcdhb19 APN 18 37498544 missense probably damaging 1.00
IGL02348:Pcdhb19 APN 18 37498808 missense probably damaging 1.00
IGL02866:Pcdhb19 APN 18 37499110 missense possibly damaging 0.91
IGL02869:Pcdhb19 APN 18 37498637 missense probably damaging 0.98
IGL03118:Pcdhb19 APN 18 37499565 intron probably benign
IGL03120:Pcdhb19 APN 18 37498156 missense probably benign 0.09
IGL03135:Pcdhb19 APN 18 37498535 missense probably benign 0.37
IGL03366:Pcdhb19 APN 18 37498612 missense possibly damaging 0.95
R0147:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0148:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0432:Pcdhb19 UTSW 18 37499535 missense probably benign 0.01
R0609:Pcdhb19 UTSW 18 37497952 missense probably benign
R1438:Pcdhb19 UTSW 18 37497962 missense probably damaging 1.00
R2255:Pcdhb19 UTSW 18 37497944 missense probably benign 0.00
R2265:Pcdhb19 UTSW 18 37497683 missense probably damaging 0.99
R3500:Pcdhb19 UTSW 18 37497479 nonsense probably null
R3708:Pcdhb19 UTSW 18 37497389 missense probably benign 0.04
R4165:Pcdhb19 UTSW 18 37499190 missense probably benign
R4166:Pcdhb19 UTSW 18 37499190 missense probably benign
R4863:Pcdhb19 UTSW 18 37499108 missense probably benign 0.00
R5217:Pcdhb19 UTSW 18 37497886 missense probably benign 0.00
R5770:Pcdhb19 UTSW 18 37498037 missense possibly damaging 0.73
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6372:Pcdhb19 UTSW 18 37497366 missense probably benign 0.04
R6454:Pcdhb19 UTSW 18 37499269 missense probably benign 0.43
X0062:Pcdhb19 UTSW 18 37497175 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAAATGCCGCAGACACAGC -3'
(R):5'- TTATCACTAGAGGCCACTTGAGC -3'

Sequencing Primer
(F):5'- GCAGACACAGCCCAAGTGAG -3'
(R):5'- TCGTGCAGACAGCTCATC -3'
Posted On2018-11-28