Incidental Mutation 'R6986:Sbf2'
ID542972
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110330615 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 333 (T333A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
Predicted Effect probably benign
Transcript: ENSMUST00000033058
AA Change: T1441A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: T1441A

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164599
AA Change: T333A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371
AA Change: T333A

DomainStartEndE-ValueType
Pfam:Myotub-related 1 339 1.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164759
AA Change: T1416A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: T1416A

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166020
AA Change: T1395A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: T1395A

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110614716 nonsense probably null
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGCTGACCCAGAGCTATGAG -3'
(R):5'- GTGTTAGAGCAGACACTGTTAATC -3'

Sequencing Primer
(F):5'- AGAGGGCAGTGCTGTTCGAC -3'
(R):5'- TCTCTCAGCTTCACAGGA -3'
Posted On2018-11-28