Incidental Mutation 'R6986:Chrna5'
ID542978
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 5
SynonymsAcra-5, Acra5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location54980880-55007779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55006457 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 429 (M429K)
Ref Sequence ENSEMBL: ENSMUSP00000150942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
Predicted Effect probably benign
Transcript: ENSMUST00000034851
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093844
AA Change: M400K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: M400K

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213960
AA Change: M429K

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217408
AA Change: M325K

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 55004399 missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54998171 intron probably benign
IGL01617:Chrna5 APN 9 55005013 missense probably damaging 0.98
IGL01935:Chrna5 APN 9 55004843 missense probably benign 0.01
IGL02613:Chrna5 APN 9 55006421 missense probably damaging 0.99
IGL03248:Chrna5 APN 9 55004639 missense probably damaging 1.00
IGL03412:Chrna5 APN 9 55004435 missense probably damaging 1.00
R0712:Chrna5 UTSW 9 55004363 missense probably damaging 1.00
R1619:Chrna5 UTSW 9 55004365 missense probably benign 0.00
R1698:Chrna5 UTSW 9 55004642 missense probably damaging 1.00
R1789:Chrna5 UTSW 9 55004651 missense possibly damaging 0.94
R1800:Chrna5 UTSW 9 55004875 missense probably damaging 0.99
R4028:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4030:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54998075 missense probably benign 0.00
R4792:Chrna5 UTSW 9 55004701 missense probably damaging 1.00
R5196:Chrna5 UTSW 9 55006519 missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54998105 missense probably benign 0.00
R5779:Chrna5 UTSW 9 54998104 missense probably benign 0.35
R6254:Chrna5 UTSW 9 55006456 missense probably benign 0.00
R6492:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R6887:Chrna5 UTSW 9 55005133 missense probably benign 0.00
R7056:Chrna5 UTSW 9 54981701 intron probably benign
R7222:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R7384:Chrna5 UTSW 9 55004833 missense probably damaging 1.00
R7653:Chrna5 UTSW 9 55002434 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGTTAACTGTAGTATTCTATGGCAG -3'
(R):5'- TCCTAAGAGCTGCTTGACTGC -3'

Sequencing Primer
(F):5'- GTCTTAGAGATCTGGGCA -3'
(R):5'- GACTGCTCACTAAGTCCAGTG -3'
Posted On2018-11-28