Incidental Mutation 'R6986:Olfr822'
ID542982
Institutional Source Beutler Lab
Gene Symbol Olfr822
Ensembl Gene ENSMUSG00000058251
Gene Nameolfactory receptor 822
SynonymsMOR113-2, GA_x6K02T2PULF-11745102-11746040
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130071210-130076909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130075330 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 307 (V307M)
Ref Sequence ENSEMBL: ENSMUSP00000150652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080460] [ENSMUST00000216879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080460
AA Change: V307M

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079316
Gene: ENSMUSG00000058251
AA Change: V307M

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.1e-49 PFAM
Pfam:7tm_1 39 288 9.3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216879
AA Change: V307M

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Olfr822
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Olfr822 APN 10 130074650 missense probably damaging 1.00
IGL01975:Olfr822 APN 10 130075270 missense probably damaging 1.00
IGL02354:Olfr822 APN 10 130075274 missense probably damaging 1.00
IGL02361:Olfr822 APN 10 130075274 missense probably damaging 1.00
IGL03184:Olfr822 APN 10 130074758 missense possibly damaging 0.82
IGL03197:Olfr822 APN 10 130074679 missense probably damaging 0.99
IGL03343:Olfr822 APN 10 130075256 missense probably damaging 1.00
R0310:Olfr822 UTSW 10 130074823 missense probably benign 0.00
R1288:Olfr822 UTSW 10 130075285 missense probably damaging 1.00
R1502:Olfr822 UTSW 10 130074872 missense probably damaging 0.97
R1527:Olfr822 UTSW 10 130075192 missense probably damaging 1.00
R3771:Olfr822 UTSW 10 130075274 missense probably damaging 1.00
R5022:Olfr822 UTSW 10 130074593 missense probably damaging 1.00
R5472:Olfr822 UTSW 10 130075029 missense probably damaging 0.97
R5552:Olfr822 UTSW 10 130075145 missense probably damaging 0.99
R6451:Olfr822 UTSW 10 130075138 missense probably benign 0.01
X0024:Olfr822 UTSW 10 130074725 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGAAGGCTTTCTCTACATGCTC -3'
(R):5'- GTTTGATCAATTCCATGTCTTCCAG -3'

Sequencing Primer
(F):5'- GCTCTTCTCACATGATTGTAATATCC -3'
(R):5'- TTTCTTGGAGATGTGAAAATG -3'
Posted On2018-11-28