Incidental Mutation 'R6986:Cgrrf1'
ID542993
Institutional Source Beutler Lab
Gene Symbol Cgrrf1
Ensembl Gene ENSMUSG00000055128
Gene Namecell growth regulator with ring finger domain 1
Synonyms1810009H17Rik, CGR19, 1110038G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6986 (G1)
Quality Score93.0077
Status Not validated
Chromosome14
Chromosomal Location46832125-46854193 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 46832129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068532] [ENSMUST00000133989] [ENSMUST00000140114] [ENSMUST00000226861]
Predicted Effect probably benign
Transcript: ENSMUST00000068532
SMART Domains Protein: ENSMUSP00000070548
Gene: ENSMUSG00000055128

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
RING 274 308 2.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133989
Predicted Effect probably benign
Transcript: ENSMUST00000140114
Predicted Effect probably benign
Transcript: ENSMUST00000226861
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Cgrrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Cgrrf1 APN 14 46832322 missense probably damaging 0.99
IGL02507:Cgrrf1 APN 14 46853444 nonsense probably null
IGL03298:Cgrrf1 APN 14 46846321 missense probably benign 0.08
R0152:Cgrrf1 UTSW 14 46853913 missense probably damaging 1.00
R1477:Cgrrf1 UTSW 14 46853438 missense probably benign 0.12
R2020:Cgrrf1 UTSW 14 46830445 unclassified probably benign
R2107:Cgrrf1 UTSW 14 46853376 splice site probably benign
R3010:Cgrrf1 UTSW 14 46853766 missense probably benign
R3801:Cgrrf1 UTSW 14 46832363 missense probably damaging 1.00
R4296:Cgrrf1 UTSW 14 46832355 missense probably damaging 0.99
R4681:Cgrrf1 UTSW 14 46853826 missense probably benign 0.00
R4884:Cgrrf1 UTSW 14 46853455 missense possibly damaging 0.82
R6010:Cgrrf1 UTSW 14 46853701 missense probably damaging 0.99
R6299:Cgrrf1 UTSW 14 46840190 missense probably damaging 1.00
R6861:Cgrrf1 UTSW 14 46832328 missense probably damaging 1.00
R6932:Cgrrf1 UTSW 14 46853722 missense probably benign 0.09
R7132:Cgrrf1 UTSW 14 46853864 missense probably damaging 1.00
R7152:Cgrrf1 UTSW 14 46853477 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGGTTTCCAGGATACC -3'
(R):5'- TTCATAGAGCGTTACCAGGAAC -3'

Sequencing Primer
(F):5'- CGTGTATCTGAGGATCTGCATTAAC -3'
(R):5'- TAGAGCGTTACCAGGAACACTGC -3'
Posted On2018-11-28