Incidental Mutation 'R6987:Zfp850'
ID543025
Institutional Source Beutler Lab
Gene Symbol Zfp850
Ensembl Gene ENSMUSG00000096916
Gene Namezinc finger protein 850
SynonymsC130069I09Rik, Gm4636
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27984854-28014115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27990001 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 261 (C261S)
Ref Sequence ENSEMBL: ENSMUSP00000141063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099111] [ENSMUST00000180024] [ENSMUST00000180502]
Predicted Effect probably benign
Transcript: ENSMUST00000099111
Predicted Effect probably damaging
Transcript: ENSMUST00000180024
AA Change: C261S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137192
Gene: ENSMUSG00000096916
AA Change: C261S

DomainStartEndE-ValueType
KRAB 14 75 1.56e-34 SMART
ZnF_C2H2 172 194 7.18e1 SMART
ZnF_C2H2 200 222 3.63e-3 SMART
ZnF_C2H2 228 250 8.94e-3 SMART
ZnF_C2H2 256 278 7.49e-5 SMART
ZnF_C2H2 313 335 1.01e-1 SMART
ZnF_C2H2 341 363 4.4e-2 SMART
ZnF_C2H2 369 391 7.37e-4 SMART
ZnF_C2H2 397 419 8.47e-4 SMART
ZnF_C2H2 425 447 1.92e-2 SMART
ZnF_C2H2 453 475 2.99e-4 SMART
ZnF_C2H2 481 503 7.78e-3 SMART
ZnF_C2H2 509 531 1.95e-3 SMART
ZnF_C2H2 537 559 1.92e-2 SMART
ZnF_C2H2 565 587 2.99e-4 SMART
ZnF_C2H2 593 615 1.79e-2 SMART
ZnF_C2H2 621 643 7.37e-4 SMART
ZnF_C2H2 649 671 4.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180502
AA Change: C261S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141063
Gene: ENSMUSG00000096916
AA Change: C261S

DomainStartEndE-ValueType
KRAB 14 75 6.5e-37 SMART
ZnF_C2H2 172 194 3e-1 SMART
ZnF_C2H2 200 222 1.5e-5 SMART
ZnF_C2H2 228 250 3.8e-5 SMART
ZnF_C2H2 256 274 2.5e-1 SMART
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Zfp850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02278:Zfp850 APN 7 28008397 missense probably damaging 0.96
R0610:Zfp850 UTSW 7 27989394 missense probably damaging 0.99
R0690:Zfp850 UTSW 7 27985217 missense possibly damaging 0.67
R0711:Zfp850 UTSW 7 27990273 missense probably benign 0.00
R1310:Zfp850 UTSW 7 27989459 missense probably benign 0.40
R1594:Zfp850 UTSW 7 27989391 missense probably benign 0.00
R1771:Zfp850 UTSW 7 27985275 nonsense probably null
R2189:Zfp850 UTSW 7 27989055 missense probably benign 0.02
R2192:Zfp850 UTSW 7 27985195 missense probably damaging 1.00
R2417:Zfp850 UTSW 7 27989183 missense possibly damaging 0.54
R4321:Zfp850 UTSW 7 27989400 missense probably damaging 0.99
R4770:Zfp850 UTSW 7 27984986 unclassified probably null
R4970:Zfp850 UTSW 7 27990233 nonsense probably null
R5112:Zfp850 UTSW 7 27990233 nonsense probably null
R5166:Zfp850 UTSW 7 27990356 nonsense probably null
R5303:Zfp850 UTSW 7 28008413 missense probably damaging 1.00
R5315:Zfp850 UTSW 7 27990318 missense probably benign 0.02
R5496:Zfp850 UTSW 7 28007346 missense probably damaging 0.98
R5547:Zfp850 UTSW 7 27989419 missense probably damaging 1.00
R5677:Zfp850 UTSW 7 27989088 missense probably damaging 1.00
R5927:Zfp850 UTSW 7 27990195 missense probably benign 0.17
R6654:Zfp850 UTSW 7 27985215 nonsense probably null
R6950:Zfp850 UTSW 7 27990514 missense possibly damaging 0.86
R6990:Zfp850 UTSW 7 27990376 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCAAAGGCTTTCTCACTGG -3'
(R):5'- AATGCTCACTTATACCTGCCAC -3'

Sequencing Primer
(F):5'- CTCACTGGAATGAATACTCTGGTG -3'
(R):5'- TTCACACTGGAGAGAAGCCCTATG -3'
Posted On2018-11-28