Incidental Mutation 'R6988:Usp32'
ID543098
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85010143 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1084 (M1084V)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108075
AA Change: M1084V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: M1084V

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACCTACCAATCCTGTGCATG -3'
(R):5'- AAACCTTTCTGTGGGTCTCC -3'

Sequencing Primer
(F):5'- GCATGGTTGCTAGCTTCTTGAG -3'
(R):5'- TGGGTCTCCACTTTAAATGGTAG -3'
Posted On2018-11-28