Incidental Mutation 'R6989:Amh'
ID543150
Institutional Source Beutler Lab
Gene Symbol Amh
Ensembl Gene ENSMUSG00000035262
Gene Nameanti-Mullerian hormone
SynonymsMIS, Mullerian inhibiting substance
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80805243-80807648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80805504 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 86 (Q86R)
Ref Sequence ENSEMBL: ENSMUSP00000043153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020435] [ENSMUST00000036016] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000151928] [ENSMUST00000180438] [ENSMUST00000181039] [ENSMUST00000181945]
Predicted Effect probably benign
Transcript: ENSMUST00000020435
SMART Domains Protein: ENSMUSP00000020435
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 52 77 N/A INTRINSIC
Pfam:JSRP 79 138 1e-29 PFAM
low complexity region 145 158 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036016
AA Change: Q86R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043153
Gene: ENSMUSG00000035262
AA Change: Q86R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:AMH_N 75 439 3e-133 PFAM
TGFB 456 554 8.57e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148665
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151928
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180438
SMART Domains Protein: ENSMUSP00000137701
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:JSRP 49 78 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181039
SMART Domains Protein: ENSMUSP00000137666
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 92 117 N/A INTRINSIC
Pfam:JSRP 118 179 1e-31 PFAM
low complexity region 185 198 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 245 270 N/A INTRINSIC
low complexity region 313 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181945
SMART Domains Protein: ENSMUSP00000137960
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate N- and C-terminal cleavage products that homodimerize and associate to form a biologically active noncovalent complex. This complex binds to the anti-Mullerian hormone receptor type 2 and causes the regression of Mullerian ducts in the male embryo that would otherwise differentiate into the uterus and fallopian tubes. This protein also plays a role in Leydig cell differentiation and function and follicular development in adult females. Homozygous knockout male mice develop female reproductive organs and are often sterile, while homozygous knockout female mice exhibit premature depletion of primordial follicles. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract and functional sperm, but also uterus and oviducts. Most are infertile due to female organs blocking sperm transfer. Females are fertile with enlarged ovaries and atypical follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Amh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Amh APN 10 80805408 missense probably damaging 0.98
R0553:Amh UTSW 10 80806176 unclassified probably benign
R1195:Amh UTSW 10 80805585 frame shift probably null
R1195:Amh UTSW 10 80805585 frame shift probably null
R1750:Amh UTSW 10 80805585 frame shift probably null
R1765:Amh UTSW 10 80805585 frame shift probably null
R1974:Amh UTSW 10 80806416 missense probably benign 0.00
R1998:Amh UTSW 10 80805585 frame shift probably null
R4425:Amh UTSW 10 80806921 missense probably damaging 1.00
R4554:Amh UTSW 10 80807051 missense probably benign
R6007:Amh UTSW 10 80805471 missense probably benign
R7257:Amh UTSW 10 80806653 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCACTGGTACTGCTGCTAG -3'
(R):5'- GAGACAGAGTCCATCACGTAC -3'

Sequencing Primer
(F):5'- GCTGCTAGCGACTATGGG -3'
(R):5'- TACCTTCAGCCAGATGTAGGACTAG -3'
Posted On2018-11-28