Incidental Mutation 'R6989:Fbxl21'
ID543159
Institutional Source Beutler Lab
Gene Symbol Fbxl21
Ensembl Gene ENSMUSG00000035509
Gene NameF-box and leucine-rich repeat protein 21
SynonymsD630045D17Rik, FBL3B, FBXL3B, Psttm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location56522472-56537898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56527061 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000112714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045428] [ENSMUST00000121095] [ENSMUST00000121871] [ENSMUST00000124981] [ENSMUST00000128668]
Predicted Effect probably damaging
Transcript: ENSMUST00000045428
AA Change: V49A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035248
Gene: ENSMUSG00000035509
AA Change: V49A

DomainStartEndE-ValueType
FBOX 45 85 4.77e-11 SMART
SCOP:d1a4ya_ 177 398 3e-3 SMART
Blast:LRR 203 228 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121095
AA Change: V75A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112714
Gene: ENSMUSG00000035509
AA Change: V75A

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121871
AA Change: V75A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112518
Gene: ENSMUSG00000035509
AA Change: V75A

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
SCOP:d1a4ya_ 203 424 2e-3 SMART
Blast:LRR 229 254 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124981
Predicted Effect probably benign
Transcript: ENSMUST00000128668
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice with a point mutation exhibit a short circadian free-running period in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Fbxl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Fbxl21 APN 13 56527709 splice site probably benign
IGL01972:Fbxl21 APN 13 56536859 nonsense probably null
IGL02450:Fbxl21 APN 13 56526953 missense possibly damaging 0.52
IGL02667:Fbxl21 APN 13 56537129 missense probably benign 0.07
IGL02945:Fbxl21 APN 13 56527170 missense probably damaging 1.00
R1535:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R1741:Fbxl21 UTSW 13 56537102 missense probably benign 0.06
R1863:Fbxl21 UTSW 13 56527063 missense probably benign 0.01
R1886:Fbxl21 UTSW 13 56527093 missense probably benign 0.24
R3176:Fbxl21 UTSW 13 56537122 nonsense probably null
R3276:Fbxl21 UTSW 13 56537122 nonsense probably null
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3733:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R4535:Fbxl21 UTSW 13 56527060 missense probably damaging 0.99
R4678:Fbxl21 UTSW 13 56537049 missense probably damaging 1.00
R5264:Fbxl21 UTSW 13 56532323 missense probably benign 0.17
R5640:Fbxl21 UTSW 13 56537381 missense probably benign 0.23
R5714:Fbxl21 UTSW 13 56527072 missense probably benign 0.29
R6640:Fbxl21 UTSW 13 56537009 missense probably damaging 1.00
R7140:Fbxl21 UTSW 13 56532332 missense probably damaging 1.00
R7180:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
X0019:Fbxl21 UTSW 13 56532429 missense possibly damaging 0.82
X0026:Fbxl21 UTSW 13 56527112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGGAATGTAAGATGACTGC -3'
(R):5'- ACTGAAGATGTGCAGCGTGC -3'

Sequencing Primer
(F):5'- GTAAGATGACTGCTAGAATTGTGTC -3'
(R):5'- GCAGCGTGCTTTTTGATGATC -3'
Posted On2018-11-28