Incidental Mutation 'R6989:Rictor'
ID543166
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6772154 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 441 (S441L)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: S441L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: S441L

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTGGCAACTTTTAGAAGCCA -3'
(R):5'- AGAATTGTAACTTCCCCTTCTTGG -3'

Sequencing Primer
(F):5'- CCATGTAGATCCTGGGATAGAACTC -3'
(R):5'- ACACAACCTATCAACTCCTTGTTTTC -3'
Posted On2018-11-28