Incidental Mutation 'R6989:Alk'
ID543172
Institutional Source Beutler Lab
Gene Symbol Alk
Ensembl Gene ENSMUSG00000055471
Gene Nameanaplastic lymphoma kinase
SynonymsCD246, Tcrz
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71869442-72603709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 71897952 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1075 (M1075R)
Ref Sequence ENSEMBL: ENSMUSP00000083840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086639]
Predicted Effect probably benign
Transcript: ENSMUST00000086639
AA Change: M1075R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: M1075R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:MAM 270 431 5.6e-10 PFAM
LDLa 441 477 5.59e-3 SMART
Pfam:MAM 484 640 5.6e-22 PFAM
Pfam:Gly_rich 730 996 8.6e-19 PFAM
low complexity region 1037 1057 N/A INTRINSIC
TyrKc 1120 1387 2.76e-140 SMART
low complexity region 1440 1480 N/A INTRINSIC
low complexity region 1551 1570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Alk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Alk APN 17 71895748 missense probably damaging 1.00
IGL00796:Alk APN 17 71905142 missense possibly damaging 0.88
IGL01096:Alk APN 17 71921896 missense possibly damaging 0.87
IGL01367:Alk APN 17 71900786 missense probably damaging 1.00
IGL01402:Alk APN 17 71874178 missense probably damaging 1.00
IGL01652:Alk APN 17 72603531 missense probably damaging 1.00
IGL01717:Alk APN 17 72603382 missense probably benign
IGL02301:Alk APN 17 71874176 missense probably damaging 0.99
IGL02403:Alk APN 17 71901393 missense probably damaging 1.00
IGL02452:Alk APN 17 71902625 nonsense probably null
IGL02724:Alk APN 17 71985460 missense probably benign 0.00
IGL02826:Alk APN 17 71869536 missense probably damaging 1.00
IGL02863:Alk APN 17 71897835 missense probably damaging 1.00
IGL02994:Alk APN 17 71949820 missense probably benign 0.00
IGL03329:Alk APN 17 71899164 splice site probably benign
PIT4382001:Alk UTSW 17 71949921 missense probably benign
R0157:Alk UTSW 17 71949845 missense probably benign 0.00
R0211:Alk UTSW 17 72603516 missense probably damaging 1.00
R0257:Alk UTSW 17 72603495 missense probably damaging 1.00
R0269:Alk UTSW 17 72603583 missense probably damaging 1.00
R0395:Alk UTSW 17 72603531 missense probably damaging 0.99
R0414:Alk UTSW 17 71899286 splice site probably benign
R0466:Alk UTSW 17 71905157 missense possibly damaging 0.51
R0526:Alk UTSW 17 71869753 missense probably damaging 1.00
R0617:Alk UTSW 17 72603583 missense probably damaging 1.00
R0781:Alk UTSW 17 71984745 splice site probably benign
R0830:Alk UTSW 17 72603200 missense probably benign 0.01
R0835:Alk UTSW 17 71869842 missense probably damaging 0.97
R0894:Alk UTSW 17 71895935 missense probably damaging 1.00
R1110:Alk UTSW 17 71984745 splice site probably benign
R1170:Alk UTSW 17 71900734 missense probably damaging 1.00
R1573:Alk UTSW 17 72603118 missense possibly damaging 0.69
R1667:Alk UTSW 17 71911567 missense probably damaging 1.00
R1748:Alk UTSW 17 72603421 missense probably benign 0.19
R1767:Alk UTSW 17 71900698 missense possibly damaging 0.73
R1836:Alk UTSW 17 71891037 missense probably damaging 1.00
R1861:Alk UTSW 17 71874938 splice site probably benign
R2905:Alk UTSW 17 71985494 missense probably benign 0.40
R2925:Alk UTSW 17 72603207 missense probably benign
R3727:Alk UTSW 17 71901400 splice site probably benign
R3747:Alk UTSW 17 71911565 missense probably damaging 0.99
R3790:Alk UTSW 17 72603432 missense possibly damaging 0.95
R3909:Alk UTSW 17 71897911 missense probably benign 0.00
R3934:Alk UTSW 17 72205954 missense probably damaging 1.00
R3936:Alk UTSW 17 72205954 missense probably damaging 1.00
R3972:Alk UTSW 17 71985447 missense probably benign 0.16
R4433:Alk UTSW 17 71899241 nonsense probably null
R4716:Alk UTSW 17 72205942 missense probably damaging 1.00
R4903:Alk UTSW 17 71869563 missense probably damaging 1.00
R4921:Alk UTSW 17 71904315 missense probably benign 0.30
R4954:Alk UTSW 17 71902692 nonsense probably null
R5377:Alk UTSW 17 71895739 missense probably damaging 1.00
R5386:Alk UTSW 17 71875012 missense probably damaging 1.00
R5551:Alk UTSW 17 71875033 missense possibly damaging 0.53
R5704:Alk UTSW 17 72603120 missense probably damaging 1.00
R5877:Alk UTSW 17 71967526 missense probably damaging 1.00
R5888:Alk UTSW 17 71874943 missense probably damaging 1.00
R6013:Alk UTSW 17 71900737 missense probably benign 0.15
R6044:Alk UTSW 17 71992100 missense probably benign 0.00
R6058:Alk UTSW 17 71869747 missense probably benign 0.01
R6126:Alk UTSW 17 71875042 missense possibly damaging 0.82
R6286:Alk UTSW 17 71880847 missense probably damaging 0.98
R6744:Alk UTSW 17 72603082 missense probably benign 0.35
Z1088:Alk UTSW 17 72205807 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGAAACCATCGAGCCCTG -3'
(R):5'- TCACACTGGTTTCCCATGG -3'

Sequencing Primer
(F):5'- CCTGGGGCAGTAGCAGGAAG -3'
(R):5'- CACACTGGTTTCCCATGGTGAAG -3'
Posted On2018-11-28