Incidental Mutation 'R6989:Arhgap26'
ID543175
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene NameRho GTPase activating protein 26
Synonyms2610010G17Rik, 1810044B20Rik, 4933432P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6989 (G1)
Quality Score197.009
Status Not validated
Chromosome18
Chromosomal Location38601534-39376284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39099629 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 119 (R119L)
Ref Sequence ENSEMBL: ENSMUSP00000121894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000148850] [ENSMUST00000155576]
Predicted Effect probably damaging
Transcript: ENSMUST00000097593
AA Change: R103L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: R103L

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148850
AA Change: R119L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121894
Gene: ENSMUSG00000036452
AA Change: R119L

DomainStartEndE-ValueType
coiled coil region 99 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155576
AA Change: R103L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: R103L

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39286551 missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39111803 missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39110451 splice site probably benign
IGL02316:Arhgap26 APN 18 38642546 exon noncoding transcript
IGL02418:Arhgap26 APN 18 39357567 intron probably benign
IGL02588:Arhgap26 APN 18 38601617 unclassified probably benign
IGL03241:Arhgap26 APN 18 39229917 missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38617673 missense unknown
R0244:Arhgap26 UTSW 18 39363131 missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38617744 missense unknown
R1533:Arhgap26 UTSW 18 39371077 missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39296872 missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39306728 missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39357809 intron probably benign
R2291:Arhgap26 UTSW 18 39357698 intron probably benign
R3611:Arhgap26 UTSW 18 38933919 missense probably benign
R3700:Arhgap26 UTSW 18 39120184 missense probably damaging 0.99
R3887:Arhgap26 UTSW 18 39229966 critical splice donor site probably null
R4621:Arhgap26 UTSW 18 38899841 intron probably benign
R4877:Arhgap26 UTSW 18 39296929 splice site probably null
R4910:Arhgap26 UTSW 18 38993637 splice site probably benign
R4911:Arhgap26 UTSW 18 38993637 splice site probably benign
R4954:Arhgap26 UTSW 18 39243641 missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39246840 missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39110472 nonsense probably null
R5232:Arhgap26 UTSW 18 38993476 start codon destroyed probably null 0.97
R5297:Arhgap26 UTSW 18 39121888 missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38642456 exon noncoding transcript
R5570:Arhgap26 UTSW 18 39099618 missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39121892 missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39286672 missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39150092 missense probably damaging 0.96
R6131:Arhgap26 UTSW 18 39286585 nonsense probably null
R6251:Arhgap26 UTSW 18 39357827 missense probably null
R6481:Arhgap26 UTSW 18 39150057 missense probably damaging 1.00
R6622:Arhgap26 UTSW 18 38899863 intron probably benign
R6799:Arhgap26 UTSW 18 39099607 missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39227412 missense probably damaging 1.00
R7248:Arhgap26 UTSW 18 39306854 critical splice donor site probably null
X0013:Arhgap26 UTSW 18 39371112 missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39150105 missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39357671 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CATGACTGAAATCCCTAAGTTGC -3'
(R):5'- TGCCGGCCTTAAAGAAATCCC -3'

Sequencing Primer
(F):5'- GACTGAAATCCCTAAGTTGCTCTTAC -3'
(R):5'- GTGTGAATATCCCCAGGTATACAGTG -3'
Posted On2018-11-28