Incidental Mutation 'R6989:Rtn3'
ID543178
Institutional Source Beutler Lab
Gene Symbol Rtn3
Ensembl Gene ENSMUSG00000024758
Gene Namereticulon 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location7425901-7483289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7456491 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 712 (F712S)
Ref Sequence ENSEMBL: ENSMUSP00000065810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065304
AA Change: F712S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758
AA Change: F712S

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088169
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088171
AA Change: F693S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758
AA Change: F693S

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Rtn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Rtn3 APN 19 7435069 missense probably damaging 1.00
IGL01025:Rtn3 APN 19 7483041 missense unknown
IGL01347:Rtn3 APN 19 7457280 missense probably benign 0.01
IGL01845:Rtn3 APN 19 7457876 missense probably damaging 1.00
IGL02217:Rtn3 APN 19 7435084 missense probably damaging 0.99
IGL03024:Rtn3 APN 19 7483090 utr 5 prime probably benign
R0399:Rtn3 UTSW 19 7457876 missense probably damaging 1.00
R0633:Rtn3 UTSW 19 7457593 missense probably benign 0.03
R0826:Rtn3 UTSW 19 7467880 intron probably benign
R1327:Rtn3 UTSW 19 7431011 missense possibly damaging 0.81
R1735:Rtn3 UTSW 19 7457911 missense probably damaging 0.96
R2093:Rtn3 UTSW 19 7456850 missense probably damaging 1.00
R3116:Rtn3 UTSW 19 7431990 missense probably damaging 1.00
R3894:Rtn3 UTSW 19 7435085 missense probably damaging 1.00
R3961:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3962:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3963:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R4161:Rtn3 UTSW 19 7483079 missense probably benign 0.38
R4960:Rtn3 UTSW 19 7456521 missense probably damaging 1.00
R5585:Rtn3 UTSW 19 7458195 missense probably benign 0.12
R5735:Rtn3 UTSW 19 7456692 missense probably damaging 0.99
R5796:Rtn3 UTSW 19 7457467 missense possibly damaging 0.48
R5807:Rtn3 UTSW 19 7456827 missense probably damaging 1.00
R5864:Rtn3 UTSW 19 7435111 missense probably damaging 1.00
R6322:Rtn3 UTSW 19 7458138 missense possibly damaging 0.60
R6703:Rtn3 UTSW 19 7435045 missense probably damaging 1.00
R6885:Rtn3 UTSW 19 7458331 missense probably benign 0.31
R6888:Rtn3 UTSW 19 7457249 missense probably benign 0.00
R6992:Rtn3 UTSW 19 7435124 missense probably damaging 1.00
X0060:Rtn3 UTSW 19 7432571 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCTGGGAAATCACTGAGAAGTC -3'
(R):5'- GCATGAAAGTGAGCTAAGTGGTTC -3'

Sequencing Primer
(F):5'- TCACTGAGAAGTCTTGCTAGAAC -3'
(R):5'- GTGAGCTAAGTGGTTCTGAAAC -3'
Posted On2018-11-28