Incidental Mutation 'R6949:Gm11639'
ID543255
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6949 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104909070 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 2931 (T2931P)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000212287
AA Change: T2931P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G T 3: 127,010,884 D679E probably benign Het
Catsper4 A T 4: 134,225,747 Y96N probably benign Het
Cnksr3 T C 10: 7,160,757 I35V probably benign Het
Col16a1 A G 4: 130,059,323 E424G probably damaging Het
Ctsc G T 7: 88,281,458 G82W probably damaging Het
Cxcr4 T C 1: 128,589,615 D101G probably benign Het
Dapk1 T A 13: 60,736,324 N635K probably benign Het
Dopey1 T C 9: 86,500,860 M282T probably damaging Het
Dpysl4 G A 7: 139,091,999 E172K probably damaging Het
Eif2ak3 T C 6: 70,878,845 I211T probably damaging Het
Fam71f1 T A 6: 29,323,906 I210N probably damaging Het
Fbxw22 A T 9: 109,382,076 W386R probably benign Het
Grm7 A G 6: 110,646,304 K146R probably benign Het
Grm7 C A 6: 111,495,729 P843Q probably damaging Het
Gtf2e2 A G 8: 33,758,698 D171G probably damaging Het
Hyal5 T C 6: 24,876,304 S59P probably benign Het
Il7r T A 15: 9,508,004 T411S probably damaging Het
Kcp T A 6: 29,484,612 probably null Het
Krcc1 T C 6: 71,284,151 Y56H probably benign Het
Lmo2 T A 2: 103,970,673 M1K probably null Het
Lrit3 G A 3: 129,789,285 T351I probably damaging Het
Mcu T G 10: 59,456,744 T38P possibly damaging Het
Mylk T A 16: 35,000,318 I89N probably damaging Het
Ncoa2 A T 1: 13,156,501 C996S possibly damaging Het
Npr2 A G 4: 43,640,597 E350G probably damaging Het
Olfr1437 T C 19: 12,322,428 Y133C probably damaging Het
Pald1 T C 10: 61,321,217 E818G probably benign Het
Phf19 G T 2: 34,904,131 Q210K probably damaging Het
Pomgnt1 G A 4: 116,154,154 V250M probably damaging Het
Ppm1l T A 3: 69,549,403 C218S possibly damaging Het
Prkdc G A 16: 15,799,989 R3228H probably benign Het
Pros1 A T 16: 62,924,575 T518S probably benign Het
Rdh8 T A 9: 20,822,707 V63D probably benign Het
Rexo1 A G 10: 80,550,636 V196A possibly damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Scn11a A G 9: 119,765,514 V1271A probably benign Het
Serac1 C A 17: 6,051,815 D395Y probably damaging Het
Syne2 A G 12: 75,965,997 D2655G probably benign Het
Tm4sf19 T C 16: 32,405,858 V8A probably benign Het
Usp3 A T 9: 66,520,690 D334E probably benign Het
Uty C T Y: 1,240,000 probably null Het
Vmn2r7 T C 3: 64,691,121 N672D probably damaging Het
Vmn2r96 T A 17: 18,597,838 L751H probably damaging Het
Wnk2 T C 13: 49,101,140 S300G probably damaging Het
Zp3r G T 1: 130,577,895 S508R probably benign Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGGTTTTAACTGTACTGGCTTAC -3'
(R):5'- TAAGCTGAACAGTTCCACCCTC -3'

Sequencing Primer
(F):5'- TGAGGCATTTCATTAGCATTAAGC -3'
(R):5'- CAGGATCTAACTATATAGCCATGGC -3'
Posted On2018-11-28