Incidental Mutation 'R6952:Dsg3'
ID543306
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Namedesmoglein 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6952 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20510304-20541310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20525159 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 276 (I276F)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070892
AA Change: I276F

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: I276F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Cga A T 4: 34,905,171 Y65F possibly damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Chit1 T C 1: 134,143,284 Y34H probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Gga2 C A 7: 121,998,888 A328S probably benign Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Mrgpra6 A T 7: 47,185,945 S243T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCATCAAGAGGTTCTAGCTG -3'
(R):5'- TAACCACCTTCAGGATGCCTTC -3'

Sequencing Primer
(F):5'- CCATCAAGAGGTTCTAGCTGGTAAAC -3'
(R):5'- ACCTTCAGGATGCCTTCATTGG -3'
Posted On2018-11-28